textarchive.ru

Главная > Документ

Сохрани ссылку в одной из соц.сетей:
171
Страницы: следующая →

1 2 3 4 5 6 7 8 9 10 ... 89 Смотреть полностью

/Pad-One-Liner

"Place your take-home messages here.

Don't have the patience to read the entire lecture notes?

Use this pad for the one-line take-home messages of the talks

Provide one line \"key points\" description of each pad:

FORMAT:

Talk subject, Talker: main etherpad link

Annotator: Take-home message

Nanomaterials, Andrew Minor: /core-Jul6-NCS

Andrew: Nano materials are stronger.

Modeling the Human brain, William Risk (IBM): /core-Jul12-AIR

Erez:

- We would be able to simulate the human brain by 2020 based on super computing capability extrapulations

- Multidisiplinar approach: Neuroscience, Supercomputing, Nanatech

- Human brain: 2*10^8 Neurons, 2*10^14 Synapses

Colonizing the solar system, Pete Worden: /core-Jul13-SPS

Erez:

- NASA and Congress aint best buddies.. (underfunding, jobs for useless projects)

- Earth-Moon equilibrium and Earth-Sun equilibrium points are natural spots for space bases

- LEO launches will be outsourced to the private sector

- Methane emission from Mars might indicate the existence of Martian life forms

- Martian moon Phobos is a desired target for exploration: close to Mars, low radiation

- Solar colonization will soon be feasible

- Export-control (ITAR law) inhibits US's space tech

Astrobiology, Chris McKay: /core-Jul13-SPS

Erez:

- UV radiation on Mars is lethal in a matter of minutes

- If 2nd genesis of life accured on Mars, it might be ethiacl to preserv the life forms, even microscopic

Rocket equations and BS tests, Dan Barry

Erez:

- 4 BS tests for rockets:

ISP,

Delta-V depending on your start and end point

Liftoff thrust/weight ratio > 1,

Center mass should be above center of center of (Balance?)

Biotech that Matters: What's actionable? , Thomas Goetz: /core-Jul14-BB

Erez:

- A 6yr traditional scientific Parkinson's research was repeated by a 1yr data mining project

Biotechnology's Darker Side, Rob Carlson: /core-Jul14-BB

Erez:- Naturally accruing photosynthetic sea-slugs can live of thcan live of sunlight

- Biofuel is currently more expensive than petrol

- new bazz: recombinant biology out, synthetic biology in

- Robot can eat biomass and energize over it

- Genetically Modified food is well accepted in US and will be come more accepted in EU

Life in the extreme: From undersea vents to asteroids and beyond: /core-Jul14-BB

Erez:

- Temperature range of life: -18C - 121C

- Extremophiles - cells that can live in extreme conditions. might be useful for space

- Magnus Larsson creates sand structures fortified by genetically engineered bacteria

- Turtle shell is a good and strong building material

- Dropping spirolina bioreactors on the moon and mars as a future food source for people

Novel Neuromonitoring technology and computational biometrics, Philip Low: /core-Jul15-MED

Erez:

- SPEARS algorithm analyze brain signal based on a signe channle

- iBrain is a home-based EEG

- Identical twins have identical brain waves: genes -> brain activity

- ECG sensors work well without skin contact (over shirt)

- Crowd-source brain wave by transmiting data over cellphones

- Company: Neurovirgin

Andrew Kogelnik, diagnostics: /core-Jul15-MED

Internet of Things, David Orban: /Jul22-The-Internet-of-Things

We must set robots free if we are to be free.

IBM Almaden Tour: /workshop-Jul22-IBM-Site-Visit

New technology will make storage devices much smaller and much faster.

Anticipating and Influencing the Future, Peter Bishop: /workshop-Jul26-Anticipating-and-Influencing-the-Future

Erez:

- You can't predict the future, you should anticipate it. You can't control the future, you can influence it.

- Disagrees with Ray Kurzweil. A disruptive event/tech is S-curve not a pure exponential. It reaches a new steady state.

- Pure exponential is the result of successive disruptive events

- Leaders are the people that takes society away from a lower maximum towards a higher maximum, which is not in a strait line (\"Creative destruction\")

- Prediction=one future, Forecast=several possible futures, foresight=combined (\"strategic foresight\")

- It is ok to make assumptions. The next step is to challenge the assumption and not just make it

- \"The most likely future isn't\"

- Techcast (/library.aspx) is a tech prediction site

- Google is starting a trading-desk based on their google-trends capabilities (and are hiring..). check out Hal Varian.

- The future wheel is a brain storming technique for forecasting future implications

- Finding the optimal extrapulation of the data: econometrics, basian netwrks, SAS.

- Impossible (0%) \x3c Possible \x3c Plausible \x3c Probable/likely (50%) \x3c Certain (100%)

- GBN is a common future casting technique

Life in the Universe - SETI, Seth Shostak: /event-Jul27-SETI

When we find inteligent aliens the protocol is:

1. verify reading

2. notify the world

3. hold response until international discussion

Yossi Vardi: /event-Jul29-Yossi-Vardi-

The traits of the person you want to invest in:

- Top expert: How do you know? friends will know

- Kind personallity: In case it doesn't work (and usually it doesn't), at least you help him out

- Their freinds reflect on them

Vint Cerf: /event-Jul29-Vint-Cerf

- IPv6 is coming and will be deployed in parallel of IPv4

- IPN (InterPlanetary Network) is a network protocol for a satellite network

- Sensory BMI is coming (auditory, Visual, Spinal), but doesn't know about mental & memory

- Next big thing: network of cloud-computers

Willow's Garage:

- To create a state of the art privatly funded R&D facility you need:

1. Money invested with good will and patience for a long time before ROI

2. ROI is not nesecarily cash, could be impact on the world

3. Hire the best people

4. Have a clear focus on what the center is about. A bunch of smart ppl without direction can get lost

5. Open source, share with the academy and the world the results, loose IP if any

6. Set the standarts where there are none and build a body of widly useful knowledge for all

"

/core-Jul2-NT

"Friday

7/2/2010

9am - 11:15pm

Merkle

NT CL1 Intro to Nanotechnology

Slides: /fileview?id=0B6vjqTaW5opaNWQyYjVhMDktNzJmNS00Mjg4LTkxN2QtNjBhZDEzOTZiZTFm&hl=en

Audio:

Part 1: http://bit.ly/drZOcZ

Part 2: http://bit.ly/a2xB4b

Part 3: http://bit.ly/c73OIw

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as are available.

Salim: Intro of Ralph Merkle

Last year, photo on wall. A favorite of the students.

Ralph Merkle: This is the opening inspirational talk.

What is the purpose of life, existance in atoms.

Health, wealth in atoms.

Atoms matter a whole lot. The arrangement matters a whole lot.

On the left you see Coal - carbon atoms.

On the right you see diamond Diamond - also carbon atoms.

Arrangement matters a great deal.

On the bottom left you see a computer chip sitting on a pile of sand

If you take the sand, add a pinch of impurities, you get silicon chips.

On the right, you have two people, one sick, one cycling - difference is how the atoms are arranged.

Three trends in our ability to arrange atoms.

\"Trends\" right.

SU, exponential trends.

1/ Flexibility - more things today than we ever could in the past.

Difficult to quantify this one, but clearly better today.

2/Precision, smallest feature sizes. This we can quantify.

We can see, very very clearly in computer wafers.

Exemplifies very clearly.

3/Cost. Straight lines on semi-log paper. More than exponential trends for decades.

1959 Feynman talk [ref]

There is PLENTY of room at the bottom.

In 1959, he pointed out that the laws of Physics did not speak against manipulating matter atom by atom.

How many have read Feynman: this is vintage Feynman. If not, you are in for a treat.

Everyone keeps pointing out what Feynman said.

Feynman got it right. That is really remarkable.

Still stands as earliest observation on this.

Molecular nanotechnology.

Definitions of scale - there are small things and small things are small.

A lot of things are \"nanotechnology\"

What is interesting is nanotechnology about manufacturing with the ultimate in flexibility, the ultimate in precision - every atom in the right place, the ultimate in low cost - just the materials and energy.

Raw materials in on left, mfg process, output products on the right.

You've been looking at 3D printer.

Evolved.

Sizes

1 meter - size of my arm

mm - about the head of a pin

1000 times smaller is a micron - red blood cells - about 8 microns. Still visible under a light microscope.

Wavelength of light is less than a micron in size.

Down another factor of 1000 - a ribosome - the molecular machine in your body that churns out proteins from DNA/ RNA. About 25 nanometers in size.

A \"typical\" nanotube is 1-2 nanometers.

Atom is a bit more than a tenth of a nanometer.

One of the big things that happened in the last few decades that happened was the scanning electron microscopes.

Yes, it was ugly.

It allowed us to see and touch and even move individual atoms in a way we never thought possible. People were amazed.

Also saw theoretical work - not only see and touch atoms.

We'll be able to build complex molecular structures - nothing in the laws of physics speaks against manipulating matter atom by atom.

We should be able to build lots of interesting devices.

General picture of what is happening.

On left, that dot. The range of things we can build today. Current ability to make things.

Set of capabilities will expand. That gray oval is at present a theoretical understanding - that should let us build a whole range of molecular structures.

We have experimental capabilities we think will be developed.

If we look at it, we have the onrushing experimental front and theoretical analysis.

As we get a better understanding and better experimental techniques,

once we have those core abilities,

there will be an explosion.

I hope to give you a taste of the magnitude of that explosion.

Industrial

Computer revolutions

New set of capabilities that will change the landscape in a fundamental way.

Not so much that Products are small set of capabilities,

that represents next 10-20 years of output. Huge range.

Insanely huge set of possibilities opened up in the future.

So, manufacturing.

How to arrange atoms.

There are basically two ways:

First, self assembly.

Second, positional assembly.

In self, they stick.

In positional, you take parts and put them together.

This is an illustration of self assembly. [slide T4 Bacteriophage]

Vibratory bowl [/watch?v=Yka5u_Ax6z8]

Track that spirals out of bowl. By the time they exit, they are perfectly aligned.

Charming device to watch work.

[Slide showing smiley face created by self assembly of DNA]

Positional assembly

Involves holding parts and putting them together.

At the scale of you and me, we have hands.

At the scale of atoms and molecules, this idea is new.

Idea is beginning to spread.

With scanning probe microscopes ... [survey of class]

You have surface and a stick.

If you have an AFM - atomic force microscope [ref]

Some measure how much surface pulls on the stick -- very snazzy.

Other technique - Atomic tunneling microscope.

You apply a small voltage, you measure the current as tip is about to touch the surface, there is a small current flow. Now you can scan across the surface.

When increases - closer. When decreases - futher away.

Get picture of surface (bumps)

[Slide with complex machine]

Ultra-high vacuum.

Picture from last year: picture of a single molecule from AFM.

Single pentacene molecule.

Diagram below molecule.

Technically a tour de force.

The AFM is able to see the Image of a single molecule - quite remarkable.

IBM in atoms - classic shot.

1990 done at Almaden.

This is really a tour de force.

Q: In what sense is that an image?

That is an image in that they scanned over the surface, following over the contours of the Xenon atoms. Took that data and produced image.

Q: Don't atoms move?

Done at 4 Kelvin. Very very cold. Atoms are stable for at least days on end.

At room temp, poof, they all vanish.

Here's another example done at room temperature.

Silicon experiment.

Put single layer of tin on top.

Here, the silicon atoms you use are actually bonded.

Making and breaking bonds.

So they are stable. Very nice work. 2008.

Summary:

http://www.nims.go.jp/nanomechanics/Science.html

Original Paper:

/cgi/content/full/322/5900/413

Here they spelled out Si - the symbol for Silicon atoms on a silicon surface.

That's an interesting capability.

We're still working on a 2D surface. Someone will build a 3D structure. Able to build something, I don't know what.

Now, the theoretical work in this area - of course - allows us to think of things that are not yet experimentally available.

Set of molecular tools to allow 3D construction of diamond.

This set would allow building of another set.

So we know that in a theoretical set - waiting for demonstration that it is feasible in 3D. Hopefully will come relatively soon.

So, what would we want to build?

On upper left, a Neon pump. We might want to pump Neon through a structure ...

Q: At 4 Kelvin?

This would be room temp.

Some could go from 100s of degrees Centigrade down to 0.

Plantary gear on right and universal joint would be able to operate right on down to 0 Kelvin.

Q: Once atoms placed together, what holds them?

We have a whole technical discussion coming up -- including deep insight into what makes atoms hold together and do what they do.

Robotic arm. 100 nanometers tall. Not only something you could build ... need positional control

Not only could you build a molecular robotic arm, but the arm, once built, could hold the tools to build more robotic arms. Builds more of itself [self-reference again ...]

How do we make big things using molecular tools?

If you sneeze the small things will all blow away.

We know that it is possible to make something BIG, like a redwood tree, from something that is small, like a seed for a redwood tree.

Suggest we could build something large from molecular machines that build other molecular machines.

Whole area: self-replication machines.

Thorough coverage of topic ... fact that I am co-author has nothing to do with my view ;-)

Quite an interesting area.

Build big things from small things.

Convergent assembly -

start small on the left. Put them together, so they are 2 nm parts -> 4 nm parts .. so size doubles at every stage. In 30 doublings you get to 1 m.

[ref]

Q:

Under a day.

One thing - interesting - speed is a scale independent constant.

If I am going 1 m/second. A nanometer per nanosecond is reasonable speed. Same as 1m/sec.

Small things moving across system - if average speed across is 1 cm/sec then it takes 100 seconds to make a 1 m object.

Speed should be quite good. Kind of interesting.

Will take a few years to develop these machines.

Economics?

Mfg costs should be low.

Lumber, wheat - made with self-replicating mechanisms.

Products are likely to be of same order of magnitude.

We'll see across the board drops in manufacturing costs.

Impact.

Computers - more powerful in the future.

Molecular computers are in the cards.

That's coming.

High density memory. Very high memory molecular memory.

1 bit per atom. Plausible. In the cards.

Health.

Today's surgical devices are too big.

In the future, molecular tools to deal with cell level damage.

Materials

Lighter, stronger, smarter, less expensive --in aerospace particularly.

Space - available to pretty much everyone.

[K. Eric Drexler ref]

You get orders of magnitude drops in costs.

Vacations in space, living in space for a lot of people.

Analysis of single stage vehicle.

Q: Time horizon?

Depends on how fast we get nanotechnology working.

I'm going to say something that is sacriledge.

We have the straight lines on semi-log paper.

It is how much work we put in, particularly early on.

Chip manufacturers have put in gobs.

Nano is getting zip money. [holding fingers together] Investments are that big.

We can bring in the benefits of the technology by putting in the investment now.

Some technologies not yet on curve.

Until they get onto the curve, a lot depends on chance events.

Babbage in 1840s

Relays used in telegraph systems. Could have used them in 1850s to build computers.

We didn't get computers until 1950s. Big delay on that one.

I'll announce in passing that envinronment would benefit greatly from this technology.

Also good to have long term planning.

Universe 13.7 bn years old. Will continue for awhile.

How many people in this room plan to be alive in 30 years ... 50 ... 100 years.

That is a political hot potato around here.

It would be nice if some better medical technology was developed in a time frame that would be useful to you: 30/50 years. So this horizon makes sense - for personal medical technology.

Life spans have been 70 years.

Question session.

Salim: 15 minutes. 2 slices. Turn around, form groups of 5-6 people.

What were 2 most important aspects.

Discussion results can be logged here: /core-Jul2-NT-discussion

Main ideas:

You need to see these things when you buid them

Disruptive nature, could change everything we do, how far away are we from the things we just saw?

Downsides? How do we keep the environment \"clean\" from nanotech? Analogy of fire and the various regulations, tools and rules we have to deal with that potentially destructive technoloigy.

Cost and temperature a problem? Temperature isn't but the higher the temp the more likely you will get undesired side reactions, these things won't be too expensive and as time goes on costs go down. Room temperature operation is likely

10:24 Break

- Molecular nanotechnology

Slides: /fileview?id=0B6vjqTaW5opaMTU0NzU3ZDQtZGY0Yi00ZTdmLThiNzgtMjI2NzBlMGVkMjAy&hl=en

10:32 Promised introduction to core concepts about atoms and how they work.

First, lead in - why do this.

Manufactured products are made from atoms.

We need to understand what atoms are and how they more.

This will be basic for molecular nano, nano, medical, whole set of concepts.

No equations.

But showing pictorially, graphically. If you want equations, you can look them up.

You will get concepts of equations.

Hard core intro.

That - a nucleus and electron cloud - is an atom

The nucleus is apoint mass. Technically, it may be fuzzy, but ignore that. It is amazingly how well you can model nucleus as Newtonian point mass.

Occassionally, Hydrogen might tunnel. None of the others do this.

The cloud kind of schmeers around.

Defined by laws of quantum mechanics.

It is a blurry cloud on the level of atoms and molecules.

Hydrogen nucleus. One proton. Proton has mass approx. 1 unified atomic mass unit [ref]

About \"1\" -- actually is 1 - actual mass close to 1.

Mass is a funny number.

Charge is +1.

Electron has mass. 1836x smaller than proton. Charge of -1.

Opposite charges attract.

Electron is attracted to proton. Reason it does not collapse is that quantum mechanics says, \"it can't\". Smaller cloud, more blur. Don't ask. It is quantum mechanics.

Carbon atom.

Nucleus - 6 protons and 6 neutrons. That is Carbon 12. Called that because you can add protons + neutrons. 6 + 6 is 12. 6 protons means it is Carbon. By definition. If it has 8 neutrons, it is Carbon 14 : 8 + 6 = 14 Radioactive. Used in dating.

Six electrons. -1 for each.

Now we get some numbers, but don't be alarmed.

1 Unified Atom Mass Unit is blah - an exact number for an AMU. Really small.

10 to the minus 27 kg.

One proton is slightly different from 1 AMU. Slightly different, but pretty close.

Carbon 12 has mass of 12 AMU - by definition.

One electron, a lot smaller in mass.

Mass of neutron is also about 1 AMU.

So. Neutrons and Protons and AMU are about same and real small.

Nucleus has N + P in it. Count them. That integer is the mass number.

Q: What is mass?

I am massive. [Patting self and hopping.]

I am multiple kilograms. In US, I would be in pounds.

Q: How is that different from weight?

I am on a planetary surface. Being attracted by gravity.

In space, I would still have mass, but no weight.

People at NASA are very careful about the differences as mistakes could cause problems on rocket flights.

Q: Mass is resistance to acceleration.

F=ma

Another way of looking at mass.

OK. That is the hairly technical stuff.

That is the core.

Atoms have nuclei - most of mass in nucleus.

Atoms from bonds. They form bonds because of the electron cloud.

The Hydrogen molecule has TWO protons. Point masses. Electrons are drawn to both protons because they are positively charge.

There is quantum fuzz - about the same size as the bond length.

In fact, what is going on, the electrons like to be near the two protons.

They like to be right between the two protons.

More electron density between the two protons - closer to both protons there.

I want to snuggle up to both protons if I can. If there is more negative charge between the two protons, they say \"Yum\" and move closer to each other. That is what is called a bond.

All about the electrostatic attraction of the electrons for the protons and the protons for the electrons and the quantum mechanics that cause the electrons to not want to be in the same place - so blurred.

Interesting thing. Bond has a certain characteristic length that it likes to be.

If you pull the two protons apart, there is a restoring force. Sort of like a spring. Pull them apart and they want to pull back together.

Stretching a bond is like stretching a spring. Oooo. Interesting.

You can say the same thing in equations. If you get the right spring constants, it is really quite accurate.

You can draw a graph. Plot energy versus bond length.

Two protons, pull them apart. Energy goes up - they don't LIKE to be pulled apart.

If I push them together, they are unhappy.

They go back to the bottom of the potential well.

This potential well describes the force between the two protons in the Hydrogen molecule.

If I know that curve, I don't have to know where the electrons are. I just need to know the shape of that curve.

I just say, \"There is a bond between the two Hydogen atoms.\" I can ignore the electrons entirely.

I am describing a bond between two Hydrogen atoms. I can describe it as a spring between two Hydrogen atoms. I have now allowed myself to think about this spring - no electrons, no quantum mechanics.

OK. Hang on tight. Replaced a bond with a spring.

Now Water. Three atoms. Two bonds. Two springs.

H in upper left and right.

Oxygen in the middle.

I've got something more. Those two hydrogen atoms are at a characteristic angle.

I need another spring. I need an angle with a spring. Those 3 like to be at a particular angle.

Goes back to shape of electron cloud.

Again, I can ignore quantum mechanics so long as I understand the angle.

Finally,there is a torsion angle. Angle around a bond.

Bond between two Carbon atoms. As I rotate, there is an angle it wants to be at.

Now I have another angle: a torsion angle spring constant.

Some people omit this. But it is often significant - especially in biological systems.

This covers the INTERNAL angles.

Semester course in molecular mechanics. This is speed learning.

Now molecules float and bump and have force between them. Called the \"van der Walls\" force. Falls off very rapidly. Weaker.

Q: Is this strong/weak forces?

No. Those are inside nuclei.

Weak forces govern radioactive decay.

We are tossing out.

Q: No gravity?

Gravity does not exisit. Picture of what is going on between atoms and molecules. Throwing out everything we possibly can. Gravity at scale of atoms/molecules - tiny.

Neutrinos? Forget them.

Q: What is attracting the molecules?

Electrostatics

Quantum forces we are very carefully getting rid of here.

.

nice you know those forces you can start to undersand a lot of things, chemistry, biochemisty, water

This is a bit of a lie, this is water but essentailly this is telling the truth, ordinary water is moving around and not as uniform

if you throw in a hexane you have an oily (hydrophobic) molecule in water and there are less hydrogen bonds. You break the hydrogen bonds.

Energetically that's bad, if you through two hexane molecules in the water you are breaking more hydrogen bonds which is not good.

If the hexane molecules snuggle up to each other you break fewer hydrogen bonds. That's why oil and water don't mix.

Hydrophobic vs. Hydrophilic

Hydophilic - parts of molecules that form h bondss sitck to both each other and water

Hydrophobic - parts of molecules stick to each other

Explains protein folding

hydrophobic parts stay inside touching each other, hydrophilic parts stay on outside bonded with each other

Simple Newtonian physics can describe the motion of atoms

Most molecular mechanics models use:

1. Bond length/stretching (interaction between 2 atoms)

2. Angle bend (interaction between 3 atoms)

3. Torsion (interaction between 4 atoms)

4. van der Waals (interaction between atoms over a small distance - sub nm scale)

5. Electrostatics (interaction between atoms over a larger distance - sub nm scale)

Again: discussioned logged at /core-Jul2-NT-discussion

Backchan.nl questions:

Do the bonds get larger as temperatures increase of do they stay the same length until their is a phase change?

brad su

What actual models - tinkertoy type of models - are available which exhibit the appropriate spring-like behaviors including torsion? Can we get some to play/build with?

John Graves Singularity University

Asimov's Laws

Immoral or illegal to \"pause\" a computer-based being?

Genero Sapiens vs Homo Sapiens Effictus

[end of presentation]

=================================================================

Question Template [for copy/paste - do not use]

Vote by adding +XX where XX are your initials (see key: )

Student Question:

Student Votes:

Student Comments:

Faculty Response:

=================================================================

Student Question:

Student Votes:

Student Comments:

Faculty Response:

Instant Evaluation:

/gsp10/feedback/week-2

GSP10 Book List:

http://bit.ly/GSP10BookList

"

/core-Jul5-AIR

"Monday

5 July 2010

9am \u2013 10am

AIR CL4 Artificial Intelligence: Applications

Neil Jacobstein

Speakers on this pad:

9:06 Neil Jacobstein

Slides: /present/view?id=0AWIj9HPeinaFZGY2cDNjOXpfMzcxY2tiNDU0ZDQ&hl=en

10:12 Ben Goertzel

Slides: /fileview?id=0B2Ij9HPeinaFMmRkZTY4NmEtMmNjMy00OGMxLTg0NGItZTQxYTYyZjdjNDZm&hl=en

11:19 Peter Norvig

Slides: /fileview?id=0B2Ij9HPeinaFMjRlOTQyZWUtMGJkYS00ODA5LTg1ZGEtYzQ1ODgxZWI4MDg4&hl=en

=============== PRE-presentation notes

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

New slide marker in Etherpad starting today:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

We may be able to use this system to create a robot presenter:

/Jul5-Robot-Presenter

Suggestions for etherpad contributor signals during talks:

.

A period at the left margin means this contributor is taking a break

=

An equals sign at the left margin means this contributor is ready to capture the next words

(their first keystroke would be a backspace)

PRIOR AIR Etherpad: /core-Jun28-AIR-CL1-Overview-AI-Robotics-Jacobstein (includes Dan Barry's CL2/3)

=============== End of PRE-presentation notes

9:06

Today we are going to talk about applications of AI.

-

The use of AI is part of a larger technology arc

-

-

Machines replaced humans as calculator drones

-

Lester Thurow - replace physical exertion with brain power

\"Standards of living rise not because people work harder but because they work smarter. Economic progress is the replacement of physical assertion with brain power.\"

- Machine Augments Human Expert: Dendral 1965 - 1980

We've been able to demonstrate amazing applications. Machines solving

In the last 50 years we've been able to get machines to solve problems which only people had been able to solve.

System used heuristics and rules of chemistry, amazingly successful.

Narrow AI expert system. Hand coded in LISP.

Since Dendral,

-

we've been able to demonstrate narrow AI in a wide variety of domains.

Can sometimes outperform people who created the system.

At Bangkok at rush hour, these systems can't compete with human drivers.

-

If it works, it isn't AI.

Now, when AI is successful, they are considered medical or manufacturing applications, not AI applications.

-

AAAI - in 1989, created an applications conference to capture and doocument the deployed and emerging applications.

Team of 25 researchers gets together and

Selects the top 20 which are presented at the AAA conference each year

There are about 460 since 1989.

You can go to the website and look at most of them, download PDFs

-

AI has been deployed worldwide.

Or in their power grid or small devices in cras and macines

And in many cases there are universities doing AI research

The range of AI applications is truly huge, ubiquitious, increasingly invisible and embedded in 'vanilla' products and services

they are distributed across wide variety of application domains

industry

government applications

-

Most of the applications, we don't know about.

No delivedrd by PDAs mobile phones and cloud computer services

Mid-1990's AI reached a tipping point.

Many people adopted it without knowing, adopted in the fact that people were using mobile phones that used AI tech

Instant credit check involves AI

- Task Automation

Only humans used to do these things.

We don't have broad human intelligence of AGI we have an amazing list of what we can do

Thinking about your team projects and what AI could do for you. This is the list of what might be relevant.

- Application Domains

DARPA has funded a lot of AI over the last 50 years.

At this year's conference, oceanography application determining when sample bottles open to sample organisms.

- Sample of AI Application

- Sources of Value Added

Acceleration is often by orders of magnitude.

Most important: EXPANDING THE RANGE OF THE POSSIBLE

Example would be really complex scheduling and planning problems

-

Beverly Park Woolf: Building Intelligent Interactive Tutors [Matt: for book list]

/Building-Intelligent-Interactive-Tutors-ebook/dp/B002ZJSVKA

Carnegie Learning for Algebra I. Really large studies, carefully controlled. 70% greater likelihood of completing subsequent courses.

If you want to build more than a page turner, with a student model, see Woolf's book.

-

Thing remarkable about DARPA BBN - 10 million element search space.

Produced improvements in productivity. Speed ups. Increased accuracy.

-

The paper system had a mechanistic causal model. Diagnosing problems. Pitch gums up systems. Used in many mills, still in use today.

-

Dick Reese said DART+ alone paid for all of DARPA's investments in AI.

Logistics Europe/Saudi transfer of materials.

C++ system

Oracle forms.

Standard linear programming package.

Off the shelf tools. Used lin prog to do optimization.

- GE Plastics Color formulation tool (/technology/computer-software-programming/1102684-1.html)

Almost old enough to vote. How would an AI system wote?? Democratic?

Big business for them. Huge savings.

Delivered over web.

An example of what you can do as a large corporation when you are paying attention and bringing a system through the culture.

-

Jack Myers collaborated with CS Harry Pople

THey built a system that wasinformally known as Jack in the Box

Building in internal medicine knowledge base.

They did quite a good job of capturing a big chunk of internal medical base

Randy built a commercial version.

Internist 1 was used in early years of capturing knowledge base

Finally, QMR had a PC version

System was remarkably effective for doing what they wanted it to do

Didn't get traction in the medical community.

-

If interested in Biomedical Informatics [Matt: another book]

Biomedical Informatics - computer applications in health care - Edward H. Shortliffe, James J Cimino

Goertzel will talk to you about a longevity gene

-

Lessons learned.

Acceptance remains elusive.

Schism between development and implementation.

Ted Shortland has discusssed.

\"Effectiveness\" discussion is not enough.

BUT adoption is a whole different thing.

Issues: culture, integration, work flow, verification, changing guidelines, finance, safety and

in the US: liability

Diagnosis is NOT the key problem.

If you are thinking about deploying into developing countries, success will depend on the availability of prevention or treatment, not just diagnosis.

-

Personal medical advice is coming along. We see now platforms to capture medical information.

Standard guidelines.

If time goes on, people working now on agents, use your data, provide specific recommentations. Will need more data.

-

Game based AI is a big win. Fastest growing. THE competitive edge. Games > Movies.

VERY big deal.

AI in these games varis.y widely

How many use such games? [lots of hands]

AI ratchets up and becomes

AI in VR environments - Second Life (see Ben)

-

AI sourcing - brings together user requirements and

Use constraints and tree search algorithms.

Hosted over 230 procurement events.

Cost savings, $1.8 bn

64-bit shared server farm

-

AI generate antenna. Evolved a solution using the criteria they had as selection pressure.

F-22 Raptor, Cockpit interface applications.

Anti-glaucoma drug - designed based on structural constraints.

Lenses are preimum optics. Used to take months, now they have captured that optical

knowledge and can now produce new lens in a very short period of time.

-

If you can produce a system that can both have domain knowledge and task search

And access to the web you can provide amazing services

Google has been able to leverage their access in Translation (Norvig)

Microsoft's Bing \"Search decision engine\" is meant to provide answers not only pointers to URL's.

Wolfram Alpha - curating knowledge. If you can state your problem in the way they have curated knowledge, it can give very sophisticated answers [ref]

SIRI takes task requests. Gives the user a very small window to help answer. Apple bought SIRI - Adam coming next week

-

Shine - built at NASA's JPL. It is blistering fast. Reason for that, they pre-allocate storage. They can get this thing to run in near real-time. Specifically designed to diagnose problems on spacecraft. Used onGalieleo etc.

NASA licensed to Biospace - useful in other domains.

/

-

Today, not just on a single workstation. AI+ other technologies. Mainstream languages.

RDF

Uniform Resource Identifier

Leveraging neuroscience - Numenta

like VitaminD?

Mainstream applications integrated with AI. Browser is GUI. And sometimes speech interfaces used in new ways.

Not technology or researcher centric, they are now built around the processes in the organization.

Can get closed feedback in robotics

-

Seen on mars. Urban grand challenge.

Robots in small slice form.

Lego kits, small amounts of AI (planning systems)

Robot soccer Neo? [ref]

-

We are not just looking at robots in macro scale. Molecular scale.

Interacting at nanoscale.

-

Map patents in nanotechnology. Early example of some interdisciplinary coordination.

-

Deployment and evolution include engineering - including social aspects.

You really need to pay attention to all the problems of getting these systems adopted by

Organizations who have resistance to change.

Very important to leverage deep domain and task knowledge.

Sometimes big win just through leveraging massive data.

-

Biological time perspective.

Some of you may think AI has had 50 years to achieve AGI, that should be enough

Compare how long it took Mother Nature - 600 million years - by that standard we are doing OK

-

When are we getting AGI?

For team project work, they use narrow slice of AI.

Whole unified theory of cognition delivering value?

Suggest: identify immediate value generators.

Make resilient decisions to cover your bets.

-

Questions?

Em: Please use mic as we are taping.

9:42

No questions?

Shary: Resources for technicalities. What is really happening? If/then?

AAAI - lot of documentation of how they do it.

Go to that site and click on applications.

Gary: Interested in Google and others. Rate web, all information. Matching same criteria we use? Google rates pages based on links they have, but you don't get that much for certain information. Different system to provide what you are looking for. Joke e-mail sparked idea. Asked you to pick a famous person. Asks you to filter answer. Will find person in 15 questions. Male/Female - will find people all over the earth. Can you have filtered criteria, the exact answer you are looking for?

Interesting question. In example you gave, it is a constrained domain. About searching for people, not other domains. If you can constrain the domain, or having people willing to hang in there for 15 questions. Google users want a SINGLE search. They click around for awhile to find what they want. You want a single answer: either contrain domain or be more specific. The way to build systems like that - see if you can require less than 15 steps, follows user and knows more. Can help provide exact match due to knowledge of user's intent.

Sasha: Expressed / implied inputs.

In most cases, most systems not understanding implied inputs. Requires sophisticated user model. Early Microsoft Bob - universally not appreciated. Tried without context to understand.

Best now are cognitive tutors.

Jan/Germany: Search engines in next decades? Wolfram Alpha - how is it different \"computational knowledge engine\"?

If you know Mathematica, you can use WA with more ease. Use that genre.

Next gen search: key is to get beyond links to documents. Will be helped by people encoding their URI - not just their documents. Right down the data item - the leaf nodes.

Just by having that massive data available.

If you can encode the semantics of the search, a la Web 2.0 or 3.0. Ontologies.[ref]

Some combination of URI and semantics.

Dmitry: How labor and time intense is development of narrow AI? Is there a way to outsource? If we know business/engineering and need it fast/cheap? What are typical conditions?

Typically there are two types of people for deep narrow AI system. A human expert who has the entire body of knowledge - typically not substitutable. Need someone available for quite a long time to extract the knowledge from and ensure high quality

Other people you need are those who can encode that knowledge sometimes the experts can do it sometimes you need someone who can tease out the model on how they solve complex problems.

Could you outsource, sure but you still need the integration of those two people.

reference to Push Singh's work - now ongoing in the Mind Machine Project as the OpenMind group: http://openmind.media.mit.edu

Need long-term patient sponsorship

9:55 Break.

Words from BBC guy: Thanks for your secrets. They were on the record. We will be in contact with some of you via e-mail. Hope you get everything you hope for from the program. Bye.

AIR CL6 The Future of Artificial General Intelligence (Ben Goertzel )

Mon, July 5, 11:30am \u2013 12:30pm

10:12 Ben (via Skype)

Sorry I couldn't make it.

AGI

Will go through very quickly - own take on history of AI.

At the end, since this is SU, I will indulge in a bit of speculation.

AGI during next few decades.

Feel free to e-mail me at your leisure. Always interested to talk.

Look at my Keynote presentation rather than my face.

Will start screen sharing.

10:14 [Switches to screen share]

AGI 1950-2050

So this talk is called, \" \"

Since you have already done some AI material,

will go quickly

1950-2050 was nice round century.

-

AGI

Artificial General Intelligence.

Define with G factor: look up

Shane and Legg? published paper with 70 different definitions.

-

Contrasted with narrow AI.

Can be quite valuable

1950 Turing test for general AI. Assume already reviewd.

Back then, they thought they could build machines like people.

-thought it would happen in the 50s 60s or 70s

didn't think it would take a half century.

-

-

Flourishing of differnet types of seach

NLP

Winograd

Lenat - math theorem

connection Machine - field going in all directions

-

1990

-

Google is an AI company

PayPal is an AI company - fraud detection

chess

planning control, unmanned vehicles, video games

Slide shows character from Black & White

-

By 2001 we were suppose to have AI -- Hal

-

Instead we got Google - narrow AI everywhere, helpful but not intelligent like C3PO

-

Useful things: car in desert

-

I've done my own narrow AI.

Biomind

Machine learning applied to biological data

mitrocondrial mutations

-

Fruit flies live 5x normal \"Methuselah flies\" [ref]

Narrow AI, but important

-

AGI is coming back

-

Series of conferences. 2010.

-

AGI - 11 next year at Google's campus [ref]

Not remotely as marginalized as it was a decade ago.

Ambitions may be done now, or at least soon.

-

Open source OpenCog [/]

Builds on dot com company

Book from 2006, the hidden pattern. Discusses philosophy of mind.

-

Book: Building better minds - whole approach in detail.

Many types of memory.

Separate types for different memories

Goals -

Attentional memory

Using system to control agents - embodies agents. Virtual embodied agents.

And humanoid robots.

-

Blow up of declarative knowledge representation. Where specialized representations come together.

Combines aspects of neural net to importance values.

They flow around like in a neural net.

Semantic net.

Most nodes have no names. Most don't correspond to English worlds or external perceptions or actions.

-

Prototype in second life. Dog controled by AI.

-

Video from multiverse.

Shows how ambiguities can be perceived relative to virtual world.

[narrates story - dog: \"grab it\" with \"it\" being disambiguated]

Not just a mocked up demo, but a screen capture from Multiverse [ref]

Dog does learn stuff and respond using OpenCog.

-

Would like to do virtual parrots

-

Virtual babies.

-

What we have done is gone from dog to humanoid. Early stage work.

Xiamen in China [ref]

Robot made by French company [ref]

chinese grad students to control French robot

Code from Brazil

Nice thing about open source approach, comes out quite international and interdisciplinary.

Built by the world, just as Linux has been. Versus secret government lab.

-

Robot can interact with people. Play.

Not most advance.

Impressed by PR2 built by Willow Garage.

Very different from virtual world. Have to deal with \"messy\" real world.

-

Video showing robot navigating around.

Some chinese guy says, \"Hey robot, go to the chair\" It navigates there.

[aside: Skype message cannot be viewed while playing video.]

Robot found chair.

-

Alright we're back.

Important thing in 2010. Robot revolution is beginning.

Sound would have helped in last video. Defect of Skype's screen share.

But, importing virtual dog code to robot, robot has to do vision processing.

Has to move head around object.

Makes it more difficult, doesn't add much. Lab is simplified environment.

Later, richer environment, more affordances, you get a better interaction.

Some reason to think that human richness comes out of richness of world we interact with.

Having some kind of interaction with a realy rich world gives system a lot of data.

Maybe system with lot of interactio with internet could do it too.

How rich does the perceptual/motor interaction need to be?

Could talk about that a long time.

Robotics is coming. See Willow Garage robot here.

Doesn't fall down due to wheels.

Woman is robot, guy is human.

-

Honda robots play soccer

-

James Albus - created for US Army

-

2020

What is coming in the future?

-

What I'm aiming at is robots and virtual agents - virtual toddler.

We can get there in 10 years. Maybe less.

I'm optimistic we could get there in 5 years with adequate funding and focus.

These are hard to come by.

We will have robot children - controlled by

OpenCog or integrative systems.

-

Robot servants.

Whether that wil happen.

Care for domestic tasttasks.

-

Robot Scientists.

Child robots + narrow AI

-

Biology interests me most.

Control AI biology equipment

AIs to surf biological papers

Put together with AGI system like OpenCog - many not be like human, but much better.

Potentially may read every paper and look at all data.

Creativity, playfulness

+ accumen of narrow aI system -> Nobel Prize winning results every day

-

More and more global brain emerging.

Internet leverages human intelligence - and stupidity and other human traits.

.

Robot service, Korea has said that by 2020 there will be a robot in every house,

Robot scientists, our robot toddlers with useful narrow AI programs we should be able to get use for early stage AGI systems.

N

Where going to see the internet have a mind of it's own (skynet via Terminator 3)

2030: A bit closer to the singularity

One big network, car, toilet, home, 3D printer, avatars in various virtual worlds, service robots, basement fusion reactor etc will all work together. Hopefully not a big brother scenario but more like the internet today. An internet bridging every virtual and physical object to speak of which will have all kinds of amazing implications.

Internet of things

-

2050: Ray Kurzweil projects technological singularity at this stage (2045)

+/- 15 years, that's about right.

- A Very Hard Problem

A cockroach projecting the outcome of WW2 - as useful as predicting what happens after that.

Goal invariance under radical self-modification:

How can you create something that gets better, but doesn't change \"spirit\".

It could have a change of heart with huge IQ.

Solvable technical problem.

- Another Very Hard Problem

Make an AGI that subjugates us all. More of a political problem.

- from Orion's Arm

When AGI really succeeds, it goes beyond all these things we've discussed,

it will be beyond human comprehension.

Hope we enjoy the ride.

[applause]

Neil: Come to front of room for questions. Don't be shy.

Michael Chen: Saw OpenCog on Singularity Summit last October. Since then?

BG: Bunch of devlopments. Robotics work is new. Extending from virtual world.

Natural language gen working much more robostly. System can express itself.

Backend improvements.

MC: Track?

BG: OpenCog developers e-mail. Blog and wiki not updated as often as it should be.

IRC channel. [ref]

Shary: Wondering to what extent current AGI is trending to human intelligence, which has emotions, intuition etc that makes us humanm, how is this integrated into AGI?

BG: People trying to emulate. Others aiming at GI. I'm aiming at latter. Not a human. Started with cognitive architecture, but no sex drive in the robot or get angry when someone insults it. Emotion and intuition are part of broad architecturs. But specific group that governs humans is not being built into OpenCog. Other researchers are.

Eric: Talked about robot child by 2020. Would this be static - same intelligence/behavior or some kind of learning that would grow?

BG: Everyghing I am doing is about learning. Child would learn. All unknow territory.

This is all uknown terrirtory, whether we can build a robot child and teach it so that it can learn and learn and become an adult. etc. We don't know yet.

Certainly AGI is all about dealing with learning systems.

AGI vs narrow AI is to learn about situations that programmer did not anticipate.

Child can deal with situation its parents never thought of.

Eric: If we get there by 2020, we don't need to do anything else because it iwll just go by itself, at least the basic mechanism?

If we get to a robot toddler, we've solved AGI. Once you have the toddler, you've made the breakthrough. Even if you have to modifiy it a bit -

\"Leap from robot toddler to nobel prize winner is much less than where we are now\"

3 to 10 year old change - genetic programs come into play. The brain changes.

You probably need to add some expert functionality. But core learning/intelligence algorithms are the same.

Bill Bing: Politics and policy associated with different areas. Roombot, not much outrage as a vaccuum cleaner. Which areas will allow more progressive use of robots and the higher level human like behaviour?

BG: Well, in large part that depends on the robotic side as well as the AGI side. And depends on cost. Neo is $15,000. Another is $100,000. Not that many can afford the PR2.

Once it crosses the cost threshold - PR2 for $5K. People will find amazing uses that we can't imagine now.

Haven't plotted exponential curve for drop in robot prices. I think 2020 - upper middle class in the developed world. Once more prevalant - more issues.

Jan/Germany: Reading about Numenta - HTM How is your approach different?

BG: I think ... I read Jeff Hawkings book on intell. Certainly true - not terribly original, but elegantly expressed. Vision processing by HTM. Many decades - bcak to Mountcastles, 1970s.

vision/ audition in human brain are HTM.

Disagree on HTM is not characteristic of all. Important for V and A.

Other had

Neocortex for cognition - comes from repitle olfactory bulb.

So cognitive cortex has combinatorial.

Different

Non-linear dynamics and strange attractors missing from HTM model.

Nice philosophy, theory of vision.

Not actuation.

Not language.

No

Tomaso Poggio/ MIT

http://mcgovern.mit.edu/principal-investigators/tomaso-poggio

E A

Binatx

/people.html

Functional / H T M based AI vision system.

Poggio closer to brain

Ent - seem to work better than Hawkins.

From lay persepctive, same structure.

Yara: Existing languages good enougn?

Church?

BG: There is a saying [Greenspun's tenth rule] that any sufficiently complex software program has a LISP interpreter in side it.

Current program languages are a

I prefer Haskell and LISP, but they're not as scalable as C++. Church - Noah Goodman's thing - that's a toy language. Not remotely scalable, even to the level of say LISP or Haskell. If you had something like that which could deal with large amounts of memory and machines like C++, that would be great. But we don't have that, and C++ is enough. We basically emulate the things that Church provides in C++. It's tempting to say \"well, AI would be easier with a better language, so we should start with the language,\" but I looked at the history and saw that people spent 10 years just building their languages, and it turns out to be really hard to build a programming language, and we don't *need* it.

EK/Argentina: 2 parts. Laws of computation,

We've made airplanes and helicopters and spacecraft, but we can't make a robot hummingbird.

Empathy has two aspects: logically modeling other people and internally simulating other person.

In principle we don't do that well, AGI could do that better. Or we could build psycho-paths. Both possibilities exist within broadly human-like systems.

Wide variance within humans. Some really rotten without good side.

Doubt that what we see exhausts range of possible. Could have REALLY sweet computer.

Justin/Canada: Great Talk. Philosophy - human / biological traits. Dawkins, Selfish Gene.

Unselfish AGI possible?

BG: Of course, it is possible. We are not limited to what we are.

[static/distortion now]

11:09

[dropped video]

Neil: we ought to reboot?

BG: [very noisy] Reeboot????

[laughter and applause]

Neil: Peter Norvig is here.

11:10

AIR CL5 Artificial Intelligence: Methods (Peter Norvig)

Mon, July 5, 10:15am \u2013 11:15am

11:19

Neil: Peter Norvig is director of research at Google Inc.

AAAI

ACM

co author of leading textbook in the field.

USC/ Berkeley - what goes on under the hood.

Peter: Always enjoy speaking with the Singularity.

Ben did a good job talking about the big picture.

I'm going to do the small picture. Bottom up.

People with vision - what is right architecture

and people looking for right pieces.

Tough task. Wrote with Stuart Russell 1200 page textbook

1 hour lecture

1/2 hour so you could have questions

Intelligent agents

Search

Logic

Planning

Uncertainty

Learning

Interfacting with the world

Language

Perception

Perceiving the world with senses

Philosophical issues

-

Four ways

Ar you duplicating what humans or doing or trying to do the best job

How successs do they act: external

Most useful - act rationally.

-

Rational agent

Percieves and acts.

Map prior perception into current action

-

Table tennis? Yes

Drive a road? yes

- list

Things in red you can't do yet.

Pink arguing

Green have been done

History of AI like history of war on cancer.

Nixon: War on Cancer. Must have lost.

But, look at cancer rates, lots of successes. Better all the time.

New treatments.

Better and batter at a lot of tasks but not one answer.

AI is like that.

- Hard questions

- Agents and environments

Agent in one box. Takes percepts. Sensors. Actuators. Black box does something.

-

Example. Has to clean stuff up. Whether dirty. Figure out right program, right sequence of actions.

Vacuum cleaner world

Is that the right function? Measure of metric. see how it performs.

-

-

More complex tracks state of world.

-

Even more complex

Keep track of state of the world and track goals

-

Most complex - utility based, not just black/white. How much is it worth.

- Problem solving agents

Define world in terms of states.

- Problem Types

Talk about attributes, how hard for agent.

Deterministic - like chess

Non-observable - sensorless problem.

Nondeterministic - solution is a contingency plan

State unknow - exploration problem - what COULD world be like

History has been one of dealing with increasing complexity.

-

Map of whole state

-

Similar problems like moving tiles around. Good theoretical

-

Algorithm no time for details

- Maap problem

- Algorithm. What comes next, until get to goal

-

-

Trade off until you reach goal.

-

skip that

-

Genetic algo

May allow parts to go together

Can combine parts of a different solutions hoping that they will solve a problem when combined

-

Eight queens problem. Can take half of left board, half of right board, put together, see how well it solves. Chance of selecting proportional to fitness.

-

What is that blob?

-

How about this blob? [fuzziness]

- Uncertainty

In early years of field, being able to represent problems.

We've gotten a lot better at this recently (late 80s)

Now we can handle problems with uncertainty.

Move from chess to robots moving around. Gears slipping. Other things.

-

Why do we need to deal with uncertainty?

Evertyhing in life has uncertainty.

Optimal route may be dterministic, but what time to leave?

There could always be earthquake, car hit by asteroid, whateer?

What is spread over time. Usually 25 min. Allow more than 25 min, but not 25 hours.

What is spread is subject fo runcertainty.

-

Uncertainty is two things, Probability and Utility

Probabilistic asserstions summarize affects of laziness and unknowns

Laziness - don't integrate everything. Get all traffic reports. Do simulation. Figure out today how long to drive to airpor. Easier to just give a few extra

Can use Baysion probabilities to summarize the problems

- Inference bu

-Normalization

-Bayes' rule and conditional independence

causal probability networks, dont have to look at all P values just those that are related to each other

- Preferences

rational axioms based on prefs.

-Rational Preferences

constraints

- Rational pref. contd.

- Maximizing expected utility

- Utilities

can map them into real numbers, think of them in terms of lotteries

1/1000000 chance you die how much would you pay to avoid? $30

-

-Decision Networks

add action nodes andutility nodes to belief networks

- Multiattribute utility

- Strict dominance

B blob dominates A blob of uncertainty

-Qualitative behaviors

a choice is obvious, worth a little

b choice is not obvi, worth a lot

c choice is not obvi, worth a little

- Strict dominance

Two attributes we know are monotonically increasing. Anything in that region is better. B is better than A.

That's when outcomes our

- Qualitative behaviors

- Inductive Learning (a.k.a. Science)

Ben talked alot about learning. Key to AI.

Think of learning as induction.

We are trying to bring it all back into learning functions.

Learn from pair of examples. tic-tac-toe.

Figure out rules, best move

- Inductive learning method

Easy generalization from curve fitting to AI.

What is best fit for points.

Best fit quadratic - seems good but point mssing

-

Higher order - which is better -

-

Here is another that fits all - but who would pick that

Occam's Razor [ref]

- Performance measurement

Shary: ??

PN: This does not have to be. Trying to do learning - Bayesian in

Performance over training set size.

- Example: linear Gaussian model

Here lot of linear models, approaches tended to be complex. As problems get bigger, more complex we get more complex features. Make the square of the variable one of the features. That technology seem to be helpful.

Slides are now available: /fileview?id=0B2Ij9HPeinaFMjRlOTQyZWUtMGJkYS00ODA5LTg1ZGEtYzQ1ODgxZWI4MDg4&hl=en

- Brains

How much on what works vs how much is it like brain.

How to model neurons

-

-

- Back prop

Math gets complex, but we don't need to go into details

-

- Hadwritten digit recog

Support vector machines

Best machine ~.6% error

Trading back and forth as techniques advacne.

- Mobile Robots

Transition to uncertain environments.

Robots is where the treads hit the road.

Messy environment.

- Localization problem - Where Am I?

One of the problems where we have had a lot of success

Dynamic Bayes net

- Localization cond

Through bunch of measures

Assume gaussian noise in moriton prediction. sensor range measurements

These are 4 measurements for range. From angle, two match well, two don't.

Too noisy to figure out where you are [relative to side or corner of box]

-

Could be almost anywhere in map.

Get more reading.

Yet more seconds of reading, figures out where it is.

So, knows for sure. Localization given a map.

- 3D mapping

Situation where you don't know map.

Whirlwind tour. You get an idea of the range.

Look up ones you are interested in.

11:50 [applause]

Sam/Australia: Noticed economic ideas came up? How much integration is there with social sciences?

PN: AI separate, but historical accident. Other fields closely aligned. In a sense, economics is one of them. Doing the right thing. Economics focuses on masses. AI focuses mostly on agents. Economics looks at individuals. AI looks at groups, but mostly not.

Control theory. AI not branch of this? Due to set of tools you have.

Strictly defining disciplines - smell of chem lab. Shape of beakers.

Control theorists had models for linear things.

Simplify until tools worked.

AI said, we want to go someplace else.

Good for exploration of different parts of world.

Things KNOWN in control that were needed in AI. For decades.

Bryce: Ethics. Concepts we deal with. Specifically. In AI, movement back to linear mapping, adding non-linear as features. Higher level predicate functions, reason being to maintain logical entailment? between functions. Connection? Montonicity? [sorry bryce - what is this term?]

Choice better, between 3 things or 1000s? Opportunity costs?

PN: First about language. relation to AI. Important from the beginning.

What it means to be human.

I see this parallel between learning algo and language - perhaps coincicdene, but common root.

Theoretical and practical.

Some not feasible. Find shortcuts.

Leads into common set of approaches. That's where they come together.

Monotonicity.

Irrationality.

I talked about split - model or best action.

I was talking about perfect rationality.

Undertand how to act human - playing poker for example.

Understand where they make mistakes and exploit that.

Bryce: Point was not irrational montonicity, but ...

PN: How you define the problem. Weakness - problem is not taking all variables into account.

As a core computational problem

Here is definition of problem

Here is how to behave rationally.

There is finite ability

If you just pose problem, not enough.

You have one click of CPU clock - what wil you spend it on.

How soon do you need decision.

You can get right answer - too many choices

Maybe ignore some of these

Much more complex.

No good theories on how to ignore things. \x3c\x3c\x3c\x3c\x3c\x3c\x3c\x3c\x3c

You'd have to write all that down.

Gary: Frrom you point of view, relating to robots. Will keep on focusing on more complicated, econometric models? or neuroscience? Some kind of organs. Much more intelligent.

PN: We want people approaching from both ends. Robots coming along well. Ben made good point - depends on how much tehy cost. Amount of work relates to how easy to get them.

1978 level of PC revolution in robots now. No Macintosh yet. Nothing you'd want to have in your house yte.

Some on neural models.

Some on rational computation.

Still need better pieces. Sensors. Actuators.

Once we have pieces, get more capable approaches.

Still at vey low leve.

Follow robot soccer - great place for teamwork.

Winners hit ball hardest, straightest.

Everybody has access to low level, focus then on high level.

Bill/US: very quickly make decisions, jsut know it (Blink [ref])?

Very good at picking out annecdotes to make compelling point. Someone else, maybe Gladwell himself, could make opposite point: quick decisions that are screw ups [tell me about it!]

Good to know there is one mode of thinking, but to say every expert acts instantaneously -- well, we don't.

Neil: Thank you Peter.

[Applause]

12:03

Em: Reminders. Anders. Last student that arrived this weekend.

Welcome.

[applause]

Lauren: you've got to say a few words. 30 seconds about how much you hate the US Embassy.

Anders: Hello. Yes. Thank you. I know nothing about what you said about yourselves.

I had some trouble with the American embasssy. all behind me. Steep learning curve.

I'm from Denmark. Another Dane here. Working with business development. No engineer, no technicial. Mostly IT systems for 10 years or so. 36. Wife 2 kids in Denamrk.

Looking forward to next 8 weeks. Thank you.

[more applausese]

Em\" E-mailed TP selections. Teams. 583C all 5 this afternoon.

Schedule shows which in which room.

Please bring all stuff out of this ballroom. We need to close it down.

12:07

[end of presentation]

c

New meta-data today for weeks 1-2:

Cumulative Etherpad document: /pads/home/week2/pads.html?attredirects=0&d=1

Pages of etherpad output (if printed as PDF): 390

Wordle of cumulative etherpad: /show/wrdl/2208722/SU_Week_2_Wordle

Python code used to collect Etherpads: /Doc?docid=0AXBeYKoQJeyQZGRxMjJnNWpfNTNkbXYycDZ4Ng&hl=en

=============

Techshop (Saturday, 3 July):

Picasa: /singularityu/TechShop#

Pad: /Jul3-Techshop

=============

TP Pads for this afternoon:

/tpenergy-Jul5-Energy-TP

/tpfood-Jul5-Food-TP

/tpspace-Jul5-Space-TP

/tpupcycle-Jul5-Upcycle-TP

/tpwater-Jul5-Water-TP

NOTE: You should already be a member and Owner of the Google Group for your team project.

"

/core-Jul16-NT

"7/16/2010

Friday

9am - 10am

NT CL7 Molecular Machine Systems

Ralph Merkle

Slides:/leaf?id=0B6vjqTaW5opaNmJiOWRmNzQtYTQ1Yi00NTdlLTljYjgtMWZkMmUzNzVjNWFk&sort=name&layout=list&pid=0B2Ij9HPeinaFOTU0MDYzNDUtOWYzMS00MWI5LTlhNmYtYzc5MWU2Y2YzYjM5&cindex=3

10:15am - 11:15am

NT CL8 Recent Developments in Nanotechnology

Brian Wang

Slides: http://bit.ly/8YYvNS (tip: there are more slides here than will be shown)

/leaf?id=0B6vjqTaW5opaMzRmN2VlYTQtODU3My00NjgxLTlhY2ItZDExNmI4OTM4NmRi&sort=name&layout=list&pid=0B2Ij9HPeinaFOTU0MDYzNDUtOWYzMS00MWI5LTlhNmYtYzc5MWU2Y2YzYjM5&cindex=6

11:30am - 12:30pm

BB CL8 Towards Homo transcendis

(TBD)

Slides:

14:30-17:30

NT Core Session

Slides: /leaf?id=0B6vjqTaW5opaOGMzMWUxYTItMjIyMy00ODVhLTg2NjEtOWY1MTNhYTZkZTBk&sort=name&layout=list&pid=0B2Ij9HPeinaFOTU0MDYzNDUtOWYzMS00MWI5LTlhNmYtYzc5MWU2Y2YzYjM5&cindex=4

9:16 Ralph: Molecular nonotechnology

Talking about ways of arranging atoms.

If you arrange a few, that will not change the world.

Can you scale that up to arranging large numbers of atoms.

- Replicative manufacturing systems.

We know we can scale things up because biological systems do it.

A seed can creat a tree.

It is possible.

Now, we want to do that in a manufacturing context.

Here we have pictures of robotic arms.

These are making other robotic arms. This is in Japan, the Fanuc Factory Group.

You can have a manufacturing system that is making more mfg system.

There is a property called closure.

Need a few critcal components to make the whole thing work.

- Replication

Many ways.

Von Neumann - a classic. The standard stored program architecture.

Also cooked up an architecture for replicating mfg systems. Also a classic.

Bacteria - very old architecture

NASA Lunar Mfg Facility - proposed in 1980

Land a big seed on the moon. Mine lunar soil.

Drexler's original proposal

Simplified HC assembler - Rob and I cooked up

Exp assembly

MEMS in Skidmore's lecture

Convergent

Waved hands and mentioned this. Good for nanofactories. Bring together

all these concepts in a nice package.

Q: Santiago: What is it? Self - replication?

Fire is self - replicatingire is self - replicating, but doesn't create anything.

Any replicating mfg system is going to be self-replicating or \"falling down\" in terms of what it can make.

RepRap is partial.

Only real example we have which is pretty well closed is the totality of the mfg system - including people - since we can make all of the things we use to mfg the things we mfg.

Bryce: Energy. Does it need to get the energy itself?

One interesting thing is defining the environment, including energy. On Earth, that means sunshine or whatever source. We have that externally.

If you define your environment correctly you can have a trivial process.

Definition of your system - if done in the right way, becomes boring.

Low cost env - then that is economically interesting.

Part of the whole puzzle of putting things together in an interesting way.

Kinematic Self-Replicating Machines

\"Finest book in the field\" since there really are not any others.

We need to describe something that is going on.

Called the \"Bunny Book\" because of the rabbits on the cover.

- A C program that prints out an exact copy of itself

Contest to find the shortest program to do this.

You can embody the concept in a very short program.

- English

Print the following statement twice, the second time in quotes:

\"Print the following statement twice, the second time in quotes:\"

Try, in your favorite language, to write a self-replicating program.

[JG: I did this in BASIC in 1992.]

- The Von Neumann architecture.

The tape contains instructions on how to build another constructor.

Reads the tape once in order to build another.

Here you see it in the process.

Having read the tape once and followed the instruction, it rewinds the tape, copies it and puts it into the new universal computer and turns on the universal computer.

The instructions are read twice- first time, do them step by step. Second time you are reading them as bits and copying them off.

- Bacteria

Von Neumann figured this out from logic.

- 1980 NASA

Gee. Getting to the moon is expensive so let's make the most of it.

If we land a seed, and that seed could mine lunar soil, build more facility and useful products, then once we landed, we could get the most bang for the buck by building more facility.

While the study in 1980 aimed for replication from a seed, it did not have to be closed. You can have vitamin components delivered, radio instructions. Maybe some critical, lightweight components.

That was back in 1980.

Price tag, $20 bn.

You too could have a lunar mfg facility. Receive instructions from the Earth and build more of itself.

Looked like it would work.

- An assembler

Drexler's idea - a device that would float in fluid. Similar to bacteria.

Extrude another device, two robotic arms would build device.

Using polymer. DNA encodes blueprints. This would be simpler, but similar.

Build a second device, then use Von Neumann to make second polymer to store in the second device.

Vacuum, closely controlled environment.

Each would produce 2 devices. Two original devices would break apart and the process would continue.

Bryce: Where does material come from?

Inside is vacuum. Outside is fluid feedstock. Binding sites would allow feedstock to be brought in. Individual molecules used. You could get access through chemistry.

So this idea was quite influential for awhile.

- Complexity (bits)

V N - cellular automata 2D world.

Exact number of bits in living bacteria, Mycoplasma genitalia 1,160,140

/wiki/Mycoplasma_genitalium

Venter's group synthesized from scratch and then bootstrap a single bacteria.

So we are seeing the ability to build genomes of that complexity.

Larger in coming years.

Drexler - 100,000,000 bits

Human 6.4 bn bits

NASA 100 bn bits

Systems which range from simple to complex.

Biological from 1 m bits up.

Mfg systems are within design capabilities of people today.

- HC assembler

Nice properties.

The replicating brick proposal.

If you want to maintain a vacuum.

Brick has XY and Z dimensions.

Extrude another brick along the long axis.

The thing that is coming OUT is coming out along the long axis. The X.

You can extrude the baby-brick from the parent brick.

You have sliding seals.

Atomically precise structures will not let individual atoms or molecules through.

You can extrude through those seals while maintaining a rigid shape.

Rigid shell enables you to extrude.

Robotic arms are building things, moving up and away. Actually moving on platform, building stuff. Reach up to ceiling, as it were, for both input and output any waste products.

Number of details in this I won't go into.

Uses acoustic design. Broadcast acoustic instructions to it.

Very flexible architecture. The brick doesn't have to store instructions.

Instructions can tell it to build another replicating device, or something useful.

Q: Andrew: One signal would activate all the bricks.

Yep. Build something useful like high-density memory.

One way of dealing with errors. If one replicative cycle has a 95% prob of success. Then one cycle will succeed. You'll get a huge population of bricks. The failed bricks will just be there, twitching, but who cares.

You'll have to filter out useless debris.

Error handling mechanism can be fairly simple.

Q: Just ideas?

This one is an idea at this point in time.

People who have replicated some -- in Lego blocks.

Designed/ built fairly simple.

Certainly not ones with any economic value.

Devices that can be built today don't have the complexity or the low cost inputs.

If you want to build something like this out of macroscopic components, but the result would be sufficiently expensive - it would be a feasibility study, not economically productive.

Same thing cropped up in Skidmore talk: if you had enough money, you could make it happen, but what is the eonomic driver to make that happen.

- HC replication (3)

Generations of offspring.

Large numbers.

- Broadcast architecture

Instead of following instructions on board the device - like Von Neumann or biology - all replication follows broadcast.

Replicator is smaller and simpler.

Decode process is simpler and easier.

Much easier to redirect assembly process.

Can't in Von Neumann approach to flip between building replicators and building wood.

Safety advantage: stop broadcasting, replicators stop replicating.

- Rotapod

- Exponential Assembly

Hand sketching hand - but robotic arm.

Cameron Slayden and Science / AAAS

Mirror image - kind of fun

- Convergent assembly

Taking components and putting them together into bigger components.

A core concept.

Allows you to go from small to big - result can be very big in not much time.

Does not have to be binary. Can be powers of 10, 5.

- Binary

4 input ports. Half scale. You get 8 parts , 4 at a time.

Get 4, then 4 more. Now you've got double the scale.

Now, 4 subassembly modules that assemble the ports - each takes 1/4 scale to create half scale inputs,

And going another step, each has 1/8th scale inputs ...

but you get the idea.

Starting from your goal, you build assemblers down by power.

After 30 steps, you've gone from 1 m parts to 1 nanometer parts.

- Some observations

Speed is scale independent.

The processing time to move things through the various stages is not going to be that long. If average speed is 1 cm /sec, then the final stage is 1 m, stage before is 1/2 m, then all 30 stages will be about 2 m.

A system which can process things, at avg speed of 1 cm / sec. in a few hundred seconds.

Turns out that the scaling arguments breakdown. Last stages you have to play around with things.

A matter of minutes.

We can build product in a matter of minutes where essentially every atom is in the right place.

We can do it inexpensively.

That should allow us to transform mfg.

- C A Error handling.

Turn off the module.

IN the bowels, there is a problem. Close the output port.

Whatever is wrong, we don't know, so we cut it off.

Will slow things down since we don't have that submodule output.

If I'm a working module, I've got 3 inputs - so i'll continue to function but at a degraded pace.

You can also do more clever things:

replacing failed modules

routing around failed modules

Once you have functional system, you can start improving on it in various ways.

Santiago: prototyped?

Concept.

What is economic driver.

That kicks in when you can build thing with precision.

Once driver is there, becomes interesting.

Santiago: When?

look at trend lines. When do we get molecular level mfg.

People don't like change.

They do it because they have to do it.

Will be expensive.

Current methods don't allow us to stay on track.

Only thing left, have to do it.

If we want to keep those trends on track.

Semiconductors are using immersion lithography.

XRays - with reflective optics. Down to 10 nm.

Continue scaling down. At some point, scanning probe microscopes.

At some point, highly parallel SPM to make precise modifications of surface to maintain resolution.

THEN switch to nano mfg because we don't have any choice.

Exhaust all other alternatives.

That is what we'll have to do.

Sasha: Have to be uniform?

Trying to define it easier for me. With 100s of people working on it things would be different.

Is Intel uniform? No, it has optimized bits and pieces.

Early on, was more uniform.

Conceptually simple so we can think about it.

These will turn into more complex architectures.

Sasha: 4 inputs, single output. Uniform. Does it have to stay uniform?

It can go wild. 10 inputs, whatever you want.

To build a specific device, you could tune stages.

Say building rods - they feed rods through, long. Assembly stage, squat.

JG: In silica. Can you do a simulation?

That would be a delightful thing. That has actually been thought about in detail.

Part and parcel of the problem. Not feasible. Don't think about it. As that process starts to move forward - looks possible, then think about it some more.

Feedback loop that gets people going \"Whoosh\"

As you think about it more- really big opportunities here.

My gosh.

In afternoon, we will talk about these enormous.

Gigantic.

Lots of work.

The sheer magnitude is SO BIG. It just begars the imagination.

The predictability that these things are going to happen.

We need to get off our duffs.

These things are just amazing. And I want them.

As people begin to internalize the idea that there is nothing between here and there but a bunch of work.

We just need to make it a goal.

Like going to the moon was a goal.

We have had \"big hairy audacious goals\"

If we do it in a timely fashion, we are going to have a LOT ...

Anyway, that's the pitch.

- Popular misconceptions.

be like living systems

be adaptable

no more so than your car

Do not put sugar lumps into the gas tank of your car

be very complex

\"Creating LIFE\" - this is wrong. Replicating systems do not need to be complex.

Inherently more complex than automobile --- WRONG

- have on-board instuctions

possible to be non-biological: broadcast model

- be self sufficient (uses only very simple parts)

Idea of robotic arm being dropped into forest - doesn't make sense.

Nonetheless, all these ideas are floating around and create infinite problems and result in funding being directed elsewhere.

- Terminology

\"self replication\" has become \"nanofactories\"

Much less problematic.

\"s r\" has implcations which are - like \"vital force\" unfortunate emotional connections.

As you talk about these things, be aware that the words you use are important.

\"Nuclear Magnetic Resonance Imaging\" - until they dropped the nuclear stuff. MRI nicely avoided that - magnets are OK.

Everyone is happy. That took care of that.

\"s r\" is not the best of terms. \"nanofactory\" is better at explaining what is happening.

- Mfg costs will be low

Core reality. Impact across all mfg products similar to computers.

Computer costs have been dropping.

We'll see that all across the board.

- video on nanofactories

10:19

10:23

10:39 Next, marvelous speaker. Technological achievements.

Blog on nanotechnology.

Following the trends, the currents. Introducing us to what has been going on.

Brian Wong: I have my blog.

- Latest Developments and Current Capabilities in Nanotechnology

- Complexity Comparison

This room, to New York, size difference.

100 nm on each dimension, something the size of a baseball stadium.

- Overview of the Talk

2D and 3D Nanoscale patterning and manufacturing

Main purpose- something purchasable by a group.

Quantum dots

Special kind - breaking into commercial applications

Self Assembly

Leverage what is naturally occuring

Memristors

Use nanowires

Sensors and electronics in living cells

Carbon nanotubes & graphene

- Aerosol Jet Printing and Printable Electronics

First of the 2D/3D is from Optimec.

Carbon nanotube ink.

Can work to higher speed.

10 microns thick- larger size

Electron mobility very fast

In right situation, better than going to lithography.

Can produce in a cabinet rather than a large clean room.

Shorter and then longer production runs

Larger and larger volumes.

Part of an industry from rapid mfg, using 20 ways to produce

extruding stuff

$1 bn per year industry

Printed electronics is bigger.

Far slower than competing lithography.

Might get up to GHz speed and faster processing

Nanoimprint

Smaller feature sizes, smaller than extreme ultra-violet. 13 nanometers

metallic-glass molds with 3D features as small as 13 nanometers.

Theoretic size limit is the size of a single atom

carbon nanotubes templates in development

Emiliano: Below 20 nm - issue of building - or flow of electrons?

Several challenges. Problem is high volume mfg.

Only 20 wafers per hour.

Need 200.

Sq feet per month.

Resists which control - everything becomes tougher. Leakages.

E: Not fundamental problems.

Well, 35 down to 28. Had 1000 engineers overcome a series of miracle.

Come up with new mix - not just pure Silicon.

When did mountain become too high, and alternate path become better?

Semiconductor roadmap.

Doing smaller next year, bye-bye kind of thing.

OR keep pushing existing lith with things closer,tighter together.

Big cost debate for which application.

A lot of stuff that the whole industry wrestles with.

Nikon makes lens, etc. Everyone has to work together.

Nanoprint - e-beam stamp once ...

- Fab in a Box

Not a lot of people behind it.

Focused Ion Beam (FIB) 6 nm feature size.

- Fab in a Box

How to make something simple - repeatable system.

A T devices in under 24 hours

- Nanotip Based Patterning

Current resolution of about 15 nm could go to 1nm

E-beam lithography systems cost up to $5 million

IBM\u2019s Desktop nanotip system will cost $100,000.

extremely small silicon tip cantilevered like AFM

thermal energy at the tip break weak bonds within the material

Created mini-Matterhorn.

They did it at 15 nm. Cost 15x less than e-Beam.

Cost is possible.

- Zyvex

Tip-Based Nanofabrication (DARPA funded) to make atomically precise quantum dots

Tip never physically contacts anything

Protection atoms leave into the gas phase

Building blocks arrive via gas phase

Is a scalable process

Extensible to many other material systems

Invariant STM tip technology

Ralph and Robert worked at Zyvex.

Scanning tips to mfg

- Zyvex APM (atomically precise mfg)

ALE growth ...

- Quantum Dots

the smaller the size of the dot, the larger the band gap

bigger gap -> more energy is needed to excite the dot -> more energy is released when returns to its resting state

Quantum dots for Quantum Film \u2013 better cameras (InVisage)

Quantum dots for better LED Lighting and LCD displays

QD laser 25 Gbps communication \u2013 Fujitsu

QD better infrared sensors

(2X now, then20-40 times better)

Useful for cameras, lighting.

Have made them to nearly atomic scale - 3 nm x 3 nm size

University of Alberta

- Quantum Dot Devices

*Quantum dot solar cells

*Quantum dot cameras

*Quantum dot displays improve efficiency of LCDs by 40%

*QuantumFilm image sensors are the world\u2019s first commercial quantum dot-based image sensors, replacing silicon.

*InVisage delivers 4x higher performance, 2x higher dynamic range

- Self Assembly

*Guided Self-assembly

*Surface topography

*Surface wetting

*Electrostatic force

*Magnetic force

Get very precise, regular structures.

Guide it. Work from molecular scale on up.

- HP now has 3 nm memristors

*provide controllable resistance

*1 nonsecond switching times

*memcapacitors and meminductors too

Structure retains what happened to it

- Memristors for Memory

Hybrid - memristors and normal

Erez: What are memristors?

Alternative to flash memory.

They have a lot of potential.

Look at electronic behavior of it. Like synapses.

But use it to replace flash memory - but with higher density.

Does not require power, like DRAM.

Erez: How does it work?

Complicated. 1000s of papers around.

How does a flash cell work - fittings around the layer.

could have memory and processing side by side

Less delay in your structure.

Memory here, processing here.

Longer delay.

Andrew: Number of papers trying to figure out how they work?

Describing it.

Andrew: But people who built it understand the principles?

Yeah. Stan Williams.

Basically like FPGA - hardware that can be adjusted on the fly. The processing structure. Does the same kind of thing. Just discovered a year ago, but coming with commercial application by using this other existing technology.

- Nano-enhanced Regular Tech

*Concrete and metal

*Research on the nanoscale that provides insight into improved control of the properties

*Nanograins for metal, almost no-creep concrete

*Hydrophobic sand

*Desert sand made hydrophobic by additive SP-HFS 1609

*The large rolls sandwich the sand between layers of polyethylene and can be produced in lengths of up to 50 metres. \u201cThe coating is done in 30 or 45 seconds,\u201d said Hareb. \u201cWe have the capacity of manufacturing 3,000 tonnes per day.\u201d

*Allows for irrigation much more effectively, roll back the desert.

*Engineering properties : composites, polymers, doping

*Nanomembrane : Desalination and water purification

*Larger Holes (4-5 nm) in zeolite for more efficient oil refining. Crack larger molecules.

*Cars, planes, buldings, subs

- Nanomed today

10-20 ways to use proteins to deliver medical functions

- Nanoshells \u2013Optical Legos

*Gold nanoshells can be used for cancer treatment

*Nanoshells are about 20 times smaller than red blood cells

*Different sizes interact with different wavelengths of light

Chiara: Get to disease?

Yes, just take out the tumor.

Chiara: Why?

Get it just there with magnets or other cell that would go to that tumor.

Virus that binds to it. Once it is all there, when you turn on your beam, it heats up to temperature and burns out the tumor.

- One Cubic Micron Devices, Sensors and Claytronics and chips in living cells

*Leading edge of today

*Phoenix Processor consumes on average 29.6pW in standby mode and 2.8pJ/cycle in active mode. Runs on cubic mm of battery

*2000 instructions to be run once every 10 minutes for sensors

*3 micron X 3 micron by 0.5 micron chips were placed into living cells

Racquel Welch Fantastic Voyage.

Have put something into a living cell.

(Not human due to that FDA thing)

Able to go in. These things have fewer processing. Need a battery to go with it using silicon.

Phoenix is the right power design to operate with the power you have. Use a very small battery or beam in the power

- Carbon nanotubes

about 1000 tons produced per year

*500 ton/year factory : Cnano Technologies

*400 ton/ year Showa Denka, 200 ton/year Bayer

*Context (carbon fiber, kevlar, copper, steel, cement)

*CNT-reinforced aluminum is only around one third that of steel, but is as hard as steel (Bayer Materials work)

*Could become cheaper than alloy method for making strong aluminum

Lots of carbon fibre

More precise carbon nanotubes in kg quantities or less

You want to find ways to mix it in with something else to get more volume.

Mix with Aluminum.

Take 10 tons of it - mix with polymer, Aluminum.

Cost, volumes

Emiliano: How long can they be?

Usually microns in size, or less. 100,000 nm might be typical.

Would look like a black powder.

But under microscope, you'd see the spagetti

E: Price?

Purity, multiwall, single wall

$100,000 per gram or kg. Can go up or down.

Min $100 per kg.

Expensive.

Especially compared to bulk materials

- Graphene

roll this up to make a carbon nanotube

not in mass production yet

electrons move FAST on this

*electrons in graphene 100 times faster than electrons in silicon

*Stronger than carbon nanotubes

*Graphene Ultracapacitors with double energy density of current ultracapacitors

*Still in lab, not in mass production

*Polymers with 0.1% graphene platelets were 40% stronger

If putting small flat pieces, how does it bond.

How well do you transfer strength to bulk, macro material?

- Nanocomp Technologies

*Bulk Carbon Nanotubes.

*Better for radiation and electromagnetic shielding

*EM shielding at one third the weight of copper

*Superior electrical properties already exist for antennas

*Can tune multiple properties in their carbon nanotube sheets.

*University Dayton \uf0e8 500 feet of 12-inch-wide fabric per day at a pilot plant (Fuzzy Fiber)

*Next 60 inch wide sheets

Lke wood fibre to newspaper.

1 cm lengths here.

Univ of Dayton

That black thing with 4 people beside it is their sheet.

Not stronger than steel at this point.

Target is for airplanes to replace copper for shielding.

Take 2000 lbs out of satellite. You are saving $20 m.

Using for antennas.

Trying to tune other aspects of the material.

DARPA - bulletproof vests or other things for vehicles.

-Lunar Cement and Concrete

*2.4-metre mirror like Hubble's

*600 kilograms (1300 pounds) of Moon dust

* 60 kg (130 pounds) of epoxy

* 6 kg (13 pounds) of carbon nanotubes

* less than a gram of aluminium

*Built a 30-centimetre disc in 2008

Make cement on the moon.

Most buildings on Earth are mudbrick

If you could make the features much better with carbon nanotubes, then mudbrick building could withstand a hurricane.

Need enough volume of it.

Use genetically engineered crop to produce expoxy.

Different way to think about making stronger housing in 3rd world.

- Properties

*Strength of materials

*Conductance

*Electron mobility

*Thermal properties

*Do more or better with less material (stronger, electrical properties)

*Find things you could not do with plastic, steel, etc.

*Do something completely new

Q & A

Open for Questions

Andrew: Water tables. Pipes lost water under cities? Retain water?

They make material, coat the sand with a liquid.

In terms of leaking infrastructure, would be difficult to use the sand approach. You'd have to dig down to the pipe - then you'd have any number of ways to fix.

Robots could crawl down the pipes.

Tar-like material over smaller hole.

Textile, wallpaper over, apply gunk to it.

Look in more detail to apply and fix it.

Pipes where they know, the pipe is open. No holes yet, but at a step in the production process. Put the sand, then the pipe.

Andrew: Can you say, how they build. Layers?

Bulldozers. 3-4 inches thick. Then push dirt back on top.

For next 100s of years, using 100x less water in that area.

: Research in reducing friction.

Yes. Any force can be vastly reduced.

Haven't see it widely applied like teflon.

Definitely in the labs

: Anything reducing friction of air over a surface.

For hype

Nanostructured Nickel Magnesium Oxide

the engineers added metal nickel to magnesium oxide, a ceramic. The resulting material contained clusters of nickel atoms no bigger than 10 square nanometers, a 90 percent size reduction compared to today\u2019s techniques

Enables terabyte computer storage

By introducing metallic properties into ceramics, engineers could develop a new generation of ceramic engines able to withstand twice the temperatures of normal engines and achieve fuel economy of 80 miles per gallon.

Non epitaxial growth to interface incompatible material

University of Maryland has created a new way to produce high quality semiconductor materials critical for advanced microelectronics and nanotechnology.

No clean room is needed

Previously incompatible material can be interfaced

no lattice matching needed

no thickness constraints

simpler and cheaper than epitaxy process

Designer Materials \u2013 inorganic nanocomposites

nanocomposites with desired properties can be designed and fabricated by first assembling nanocrystals and nanorods coated with short organic molecules, called ligands.

These ligands are then replaced with clusters of metal chalcogenides, such as copper sulfide. As a result, the clusters link to the nanocrystal or nanorod building blocks and help create a stable nanocomposite. The team has applied this scheme to more than 20 different combinations of materials, including close-packed nanocrystal spheres for thermoelectric materials and vertically aligned nanorods for solar cells

Billions of self-assembled, light-sensing, DNA nanostructures

foundation for molecular-scale logic system

Can absorb and react to light

Can trigger release of another wavelength

Reconfigurable Metamaterials Terahertz Lens

ultimate metamaterial lens \uf0e8change all of its properties

spacing and the rotation of the split-ring resonators

Split ring resonators \u2013 gold ring with small cut

Heating or cooling changes how lens bends light

Can flip direction light bends

Nanopantography

Nanopantography uses microlenses placed on a substrate (the surface that is being written upon) to divide a single ion beam into billions of smaller beams, each of which writes a feature on the substrate for nanotech device production

simultaneous impingement of an Ar+ beam and a Cl2 effusive beam on an array of 950-nm-diam lenses can be used to etch 10-nm-diam features into a Si substrate, a reduction of 95x.

Simulations indicate that the focused \u201cbeamlet\u201d diameters scale directly with lens diameter, thus a minimum feature size of 1 nm should be possible with 90-nm-diam lenses that are at the limit of current photolithography.

We expect nanopantography to become a viable method for overcoming one of the main obstacles in practical nanoscale fabrication: rapid, large-scale fabrication of virtually any shape and material nanostructure. Unlike all other focused ion or electron beam writing techniques, this self-aligned method is virtually unaffected by vibrations, thermal expansion, and other alignment problems that usually plague standard nanofabrication methods. This is because the ion focusing optics are built on the wafer.

Thermoelectric

Roadmap

Block Co-polymers

Block copolymers

UCSB claims self assembly block co-polymer features on silicon (5-20nm). Making improvements (like cross linking for faster manufacturing)

Advanced Lithography and Beyond

Mainstream: lithography, nanoparticles for medicine and more, carbon nanotubes and other nanotech and nanostructured materials, Scanning Probe Microscopy and other microscopy, aerojet printing, arrays of dip pens, MEMS/NEMS, nano-enhanced regular tech, better sensors, detection devices and tests

Enabling: Computational Chemistry, Superlenses, Lab on a chip

Progressing: DNA nanotechnology, self assembly, graphene electronics, quantum dots, quantum computing, nanostructures for tissue engineering, nanomembranes/nanofiltration, nanophotonics, molecular electronics, spintronics, plasmonics

Basic capabilities and funded development: atomic layer expitaxy and deposition, mechanosynthesis

Other: RNA, DNA, proteins, avogadro scale computing, claytronics, synthetic life

Beyond CMOS

Emerging Research Device Technology Candidates are being evaluated. A list of devices being considered to go beyond CMOS.

- Nano-electro Mechanical Switches

- Collective Spin Devices

- Spin Torque Transfer Devices

- Atomic Switch / Electrochemical Metallization

- Carbon-based Nanoelectronics

- Single Electron Transistors

- CMOL / Field Programmable Nanowire Interconnect (FPNI)

Microscopy

STM

SPM

AFM

Superlenses

Hyperlens

Diamond

Switch higher frequencies (10-120 Ghz) and voltages for power chips (MESFET, rf, 100 watt x-bands)

High power devices applications include satellite communications, telecoms base stations and compact, high resolution phased-array radars

2 tons of power electronics per railcar can be 50 pounds

Great thermal conductivity, reaching 2,000 Wm-1\u00b0C-1 for mono-crystal, which is the highest of any solid material (4-5X higher than silicon carbide and copper)

diamond is vastly better substrate

Single crystal diamond across wafers much bigger than an inch and a half

polycrystalline diamond films (5 nm grains of carbon, 20-30 atoms across)

nanocrystalline diamond onto 300-mm (12-inch) wafers in lab

Commercially 50-100mm polycrystalline diamond wafers, 150mm soon

ADT\u2019s ultrananocrystalline diamond (UNCD) is naturally insulating but can be made highly conductive by doping it with nitrogen

Doping (change and control properties) and scaling problems solved

Silicon MEMS operate at megahertz

Diamond MEMS can be gigahertz

Computational Chemistry

Computational chemistry is a branch of chemistry that uses computers to assist in solving chemical problems

Computing power and methods have advanced to where it is now possible to use molecular simulations to predict important engineering properties of real materials with a high degree of accuracy.

Anton Supercomputer, Nvidia Tesla

NanoEngineer-1 is an open-source (GPL) 3D multi-scale modeling and simulation program for nano-composites with special support for structural DNA nanotechnology.

Nanoparticles

Nanoparticles for diagnosis and delivery of medicine

Tobacco mosaic virus is like a 18-nanometer wide straw, which can hold gene silencing RNA

2007 total market for nanotechnology-enabled drug delivery will rise to $26 billion by 2012 from its current size of $3.39 billion, representing a compound annual growth rate of 37%.

Advanced Lithography

Double, triple & quadruple patterning (down to 11 nm)

E-beam

IBM 3D Nanotip based patterning

EUV (with quadruple patterning down to 5 nm)

Nanoimprint (13nm now \uf0e81-2 nm with CNT)

Self assembly (down to 2 nm)

Plasmonic lithography

Resolution augmentation through photo-induced deactivation (RAPID) lithography 40 nm now (10nm)

Ion beams

Through silicon via (other 3D techniques)

Different materials

Long List, Different Ways Forward, things will work down to 1-2 nm eventually and at reasonable cost and volume (Intel plans for 8nm in 2017)

DNA Nanotechnology

DNA origami

DNA movement and placement of nanoparticles and carbon nanotubes

New bases and chemistry

DNA separation of carbon nanotubes

DNA factory (50 steps now)

All computer circuits made in DNA

3d DNA Nanotechnology

DNA boxes

DNA tubes and other shapes

Defining Nanotechnology

Nanotech has many definitions

It has to do with very small things

HP Believes Memristor Memory could be better than Flash by 2013

Graphene Mass Production

Rice University - Stronger superacids can separate graphite into sheets of graphene and bring them into solution.

Graphene Synthesis on Cubic SiC/Si Wafers could make volume graphene electronics

This afternoon we'll be discussing, if we had something like that, implications would be kind of sweeping.

[applause]

BRIAN WANG

OVERVIEW

2D 3D nanoscalle Patterning and manufacturing

quantum dots

self assembly

memristors

sensors and electronics in licing cells

carbon nanotubules and graphene

Aersol jet printer for printing electronics, flat rate of production

qunatum dot is a small piece of semiconductor, smaller the size the larger the band gap

bigger the gap thie more energy required to excite the dot

HP now has 3 nm memristors - replacement for flash drive, nano scale resistors

provide controllable resistors

1 nanosecond switching times

memcapacitors and meminductors too, physcial structure can retain what happens to it

Memristors for Memory - hybrid

Nano-enhanced Regular Tech

Hydrophobic Sand

You can save irrigation water by layaring the foundation with this sand and keep the water closer to the roots

Nanomed

nanoshells - optical legos

20 times smaller than red blood cell

different sizes interact with different wavelengths of light

gold nanoshells can be used to treat cancer

deliver the particles somehow to cancer cells

laser heats up and burns up cancer cell

Criticism of Nanotech, Fantastic voyage - Raquel Welch

Cubic Micron Devices, Sensors and Claytronics and chips in living cells

the leading edge of nanotech today

phoenix processor uses little power from little battery or beam power to it

Carbon Nanotubes

500 tons/year factory: Cnano tech

for fevlar, walls, carbon fiber, copper, steel, cement, aluminum, polymers

CNT reinforced alum is only 1/3rd weight of steel but just as hard

could become cheaper than alloys

Length so far is 100,000 nanometers a few microns

looks like a black powder

Lunar cement

2.4 meter mirror like hubble's

600kg of moon dust, 60 kg of epoxy, 6 kg nanotubes, less than 1 kg of aluminum = cement

11:23 [applause]

Merkle: 5 min break.

11:33

Andrew Hessel

Audio: http://bit.ly/bTibXS

How are you guys feeling?

Like eating a big meal. You need to sleep.

Towards homo evolutis

There has been a lot of information thrown at you.

Last year, I gave one talk and walked away.

What I learned, some of what I talk about should have come at the beginning.

Would have set the stage for the biotech.

What I'm going to say now should come at the end.

Not all of this is immediately useful.

Biotech in particular, generating tons of data.

I'm going to take you one step further.

Talk is called \"Towards homo evolutis\"

Used by Juan Enrique in 2009

Synth genomics

We can write genomes, including our own

That changes the dynamic of everything going forward.

I'm thinking of this compulsively.

I started with computers.

Human operating system has been stable for 3 billion years.

I did this in the biotech realm for 7 years with researches and since I left I have focused almost exclusively on synthetic bio, ability to write DNA and create organisms

E. coli. looks like a hot dog. All it does is grow.

When it gets to a certain size, it pinches and duplicates.

It's like making sausages

because they double every 15 minutes, overnight you can have billions.

The true exponential growth.

Today you can do a bacterial genome in an afternoon

I had 60-70 years of stored bacteria.

We put a stab of bacteria on growth medium and put a cork in them just like wine

Still viable 60 years later.

In a minus 80 freezer, might last 1000s of years.

They find bacteria miles and miles down from thousands of years ago and they are still viable

WHat was really incredible is freeze drying them as another way to store them

put it under vacuum, which sublimes off the water quickly, then heat seal the tube.

It's what happens when anything gets exposed to space

You could boot up bacteria from a billion years ago if you could find it.

Really tiny genomes but very complicated organism, we don't unsderstand them let alone our own genome

They feed us in our guts and we have 10 times the number of their cells than ours

They've been to space, Dan Barry took a few trillion with him, which is fine since they can be exposed to space and live and just float

E. Coli are my favorite organism, they're like my gf

my new gf is synthia

her dad is Craig Venter, incredible guy, kind of a dick oops no he needs to be, you need to be strong to push over a huge field like biology and he has

In 95 he sequenced the first bacteria using Henry T Fords model

Then the human genome with Celera

/wiki/Celera_Corporation

ten years later we did synthia

You guys have the opportunity to author genomes.

You've closed the cycle.

YOU MUST UNDERSTAND THIS:

In my world view, cells are computers, they literally process information, just not electronics, chemicals. They do it extremely well, with parallel processing.

Cells are analogous to computer FACTORIES.

Bacteria are at the center of each snowflake.

I'm a network of 100 T cells.

DNA is a language. A programming language.

It is digital. You can read it unambigously. Everything else in a cell is happening in a fluid. We have to kill it to study it.

DNA is easy and cheap to read.

Run it through a sequencer, then let the computers crunch it.

ion torrent - best reader.

Not ATGC. They use cute symbols instead. [For Arabic users, for example.]

/

It's a very very sensitive pH meter, when a base is added it kicks off an ? Which raises the pH that can be seen and then correlated to which base was added

It would not surprise me at all if it fits in the side of a cell phone.

Microscope in a cell phone.

/2010/07/06/10-cellphone-microscope-wins-3-awards-heading-to-africa-for-tests/

Comprehension

It is just going to be free one day. Bottleneck in the short term is how to store that data.

Cost per gigabyte is low, but not falling as fast as sequencing cost of DNA.

You can sequence a human genome in a few days, but it takes a year of analysis.

Alumina

Bacteria - easier.

You have to think at metabolic pathway level.

[big hairy network diagram]

This looks like FaceBook.

I can't make heads or tails of this.

Tools we have to measure interactions is not up to the task yet.

Will take some really sophisticated programs.

How then do you apply it to humans.

Work moving into industrials - no FDA approval.

Get to market faster.

People just walking away from human health.

23andMe and other companies. Incredible.

5 years ago, study took millions of dollars.

Now you can get it for, like, $4.99.

Will link seamlessly with FaceBook someday.

I've been done twice.

This is really cool.

Only going to get better.

Expect full exome one day.

We'll find a business model for it.

Some of you were at the meeting. FDA has just woken up.

What relationship will you have with your own DNA.

Maybe go get a law degree.

Writing

This is my passion now.

26 letters and a bit of punctuation lets you write any book, in English.

Recombinant DNA. Cut and splice.

This is analogous to that process - ransom note writing.

This took me 1 hour and 20 min.

Can't be automatically spell checked.

Scissors and glue.

Doing DNA required 1000s of scissors, you can't see you are cutting,

make a change ... oooh.

In 2004, doing all this in software.

GenoCAD \"what do you want to make today\"

Editors on-line - they don't look really friendly yet. You kind of have to be geeky. This tool makes you better than anyone in biotech 10 years ago.

Here, you hit PRINT, it goes into synth queue and you get it in the mail in a few days. They are getting quicker and quicker.

20% of you, experienced in biotech, but 80% have no idea of where to start.

We've got to change some things in this system.

Santiago: Do we know the semantics enough?

Different problem. You can copy something much larger, but we do not have that whole model yet.

Most sales are single proteins at end of metabolic pathway.

You have the capabilities of a major biotech company.

What do you want to do?

Dean Kamen. Grew FIRST. Love that story.

I worked in biotech. Invested $1 bn per year. Didn't get new drug for 7 yrs.

Walked away. Went to Thailand.

Scary when the biotech business can't see the vision of writing DNA code.

iGEM -

From one team, just like US- FIRST,

last year 112 teams. Each kid is one of the next generation of genetic engineers.

Others are \"reverse\" engineering.

These are makers.

When their rubber hits the road, you will see some really interesting things happen.

First computer. First were toys. Spent a lot of money on them.

Still so cool you wanted to go play with them.

iGEM is still at the toy stage.

It is getting covers of prestigious journals.

Top of the drugs being sold today - literally 80% are single proteins and anti-bodies which you could knock off with these.

5 genes in Canada. Made national news.

1.2 m in funding follow on.

The power of this technology 3 years ago.

Mackenzie in.

You may have missed, - he is going to Geneva.

He has a BSc, not a PhD.

Who do you admire in computer industry -

Bill Gates

Larry - these guys didn't finish their degree.

Stick in the rigid educationalpathway, which addresses the MIDDLE,

This is the first school to address exponential technology.

You are all a little tweaked.

I hope you focus on biotech. here now. Waiting for this to happen.

It is also virtual.

If we were growing microbes, we'd be in violation of so many rules.

Labs have to move digital.

Rob Philips Digital Radiance - cells you can fly into.

Kids have trouble looking at magic of cell in flat 2D structure.

When you can dig in.

Digitize entire lab.

Game that was actually accurate. The old techniques used in a modern lab.

The next labs - the ones you will be building - may be outsourced.

Next week. Mon-Tues. A biofab.

/

Academia does things pretty well, but business does it better.

There will be biofabs like Kinkos.

Vaccine development.

Something you want to make.

Will not stay at bacterial level for long.

Dozens of iGEM teams.

I'm compulsive. Maybe arrogant. I called every university in Canada and said, \"Get students involved in iGEM. They will know more than you.\"

I sometimes had to go through whole phonebook, but I'd find one.

What are you going to make with this technology.

There are millions of living things.

Incredible diversity.

For 100s of years people went around just cataloging stuff.

Billions of things at microbial level.

Try the bottom of the ocean - vents.

Life just teems.

So exciting what can be made with DNA code. Just ATGC.

What nature selected for.

Nature is a bitch. A competitive environment.

Surprising it all works.

As you are doing your team projects:

Water / Power / Upcycling

Chances are there is something biological.

you have tools at your disposal. Put on your hat and look a little bit out.

One of the first - biofuels. Not the best to work on - a few bucks per liter.

Support around this space. Not a lot of FDA regulation.

Turn sunlight into something really useful.

Doesn't have to be fuels. Any component of any living organism.

Cross platform.

Do it for environmental remediation.

Biology will clean up mess in Gulf now.

Producing plastics.

More and more going biological.

Anything you make with biology can be degraded by biology.

Organovo. So much fun.

In higher organisms, you have a genome that can support entire process.

We can't measure that process easily.

Maint and operation.

We are not hacking up baby embryos

We can put all the design into a printer and the cells can fuse together.

Maybe Kamen will have a new bioleague in US - FIRST.

Any ideas? iGEM and US FIRST would be really interesting.

I really like microbes for space.

Still wrong taking the seed.

Take a blank seed and a DNA synthesizer.

Tipping point in Peter's mind.

Make a vaccine here and bring these tools to the world in a way that is as common as our laptops.

Put it into bioreactors. Make really powerful products.

When we get past yeasts into furry, purring organisms, we won't be so scared of them.

1000s of species of dog that we bred from wolf.

Put a chip in their brains. Lions and tigers that are docile. Really cool stuff.

We still need rockets, but one day we will be sending Coke can sized tools to other worlds to grow ecosystem before we get there.

H2N1 hit when I went to Mexico.

They shut down Guadalajara.

/wiki/Guadalajara,_Jalisco

If I sneezed, people ran away.

Fear spreads faster than any virus.

We need a distributed sensor network.

[photo of sneeze]

Not missle defense, it is SNIFFLE defense.

Some of the things we need in the world going forward.

DIYbio is being targeted as a potential threat.

Part of the first layer of expertise.

Lot more risk of scientists focused on publication,

not regulation/risks.

I've seen really scary projects in biotech.

Nature has tried to tweak genetic code.

Maybe nature doesn't do it because, it would be like having 100 different internets. They would not talk to each other.

Be really careful about - not regulation, regulation - which would choke economy and drive opportunities elsewhere.

My work is cracking the failure of drug development.

Health is not on an exponential.

60 years of innovation.

Process is so complex with so many stakeholders.

Never been able to accelerate.

Regardless of how much money we put in.

To apply data we are collecting and move forward.

N1 medicine.

Each of us, there is no control for our complex lives.

We are getting sophisticated enough to evaluate those risks.

Make medicines for ourselves.

You want your own biotech company. Buy 1 share. You'll be a full member.

Grow like Linux.

- cooperative membership

Fascinating people.

Like open source, it can go into the corporate realm.

Derek: Pink army?

Just waiting for energies to stabilize.

I do want you to become members.

Santiago: How mitigate risks that make you afraid?

What makes you afraid is different from what makes me afraid.

If I had end stage cancer, I'd be in a different place.

\"You are here\" a new branch to this evolutionary tree.

This took 4 b years.

Synthia - always copy first before you start to

100 m years per calendar year.

May be much faster depending on tools and technologies.

You might have synthetic pets in 40 years? 20 years?

syn and methlyations.

Darwin did not see this coming.

That we'd start to forward engineer.

Natural selection does not apply to us anymore.

Can we make enzymes that make diamond.

or just expresss it in our skin.

Without those constraints - we can build the environments these creatures live in.

Homo evolutis.

We reimagine ourselves in this century.

That is something to think about.

Venter is teased about playing god.

I think it is a responsibility we have to take seriously.

Something spiritual about it as well.

It has to be about doing good things. Not profit.

We need to work together to do that.

These little bacteria growing on a plate will change the world.

It will make us happy.

And be a little weird (smiley face with three eyes).

12:30 [applause]

Q: Is lack of concern from DIY based on ...

A: All of the above. They are self-identified, coming to meetings.

Recreating all the equipment.

Q: Erez. Thank you for a wonderful visionary talk. Humanity genome will be about an Exobyte.

A: One copy. Dynamic genome analysis.

6x faster data generator than Moore's law.

Maybe we'll get an up-step.

Q: Erez: Drug mfg today is not new technology, needs a new system.

A: Yes.

Some countries have assisted suicide. Why do they need an FDA?

As we get more and more sensor technologies, more will become automatic.

Q: Sasha: As we translate genetic information into digital - is there a consistency?

Q: Gene ontologies quite early on. Pretty good structure. Other layers have different formats. Still in early days.

Bio-brick.

Doesn't have a business model yet.

May end up something like Apple app store.

Just pick up the seeds, instead of going to Home Depot.

Cross over may be food. As we start to do boutique food. You know the designs, health effects. More interest in the outputs of genetic engineering. Design also does the manufacturing.

Q: Tony: Synthia - how much do we understand.

A: Copying the gene is easy. We don't understand how it does all the replications. People are hacking that. We'll get first protocells.

Life is modular.

We are 100 T computers.

Have a good lunch and a great summer.

Salim: Stress over ignite?

Rationale for this. Never enough time to get them done in a proper way.

This is deliberate. A little bit stressful. We want to see these cracks, so when you in the real world, it is a lot more polished.

Will be around for feedback this evening.

Candice: Order?

Salim: Randomly.

== end

Afternoon pad: /core-Jul16-NT-afternoon

"

/core-Jun30-NCS

"Wednesday

6/30/2010

14:30

Brad Templeton

NCS Core track

Slides: [Manuel Zaera]

All Our Ideas: /gsp10ncscore

Kathryn will review later looking for any [ref] markers.

She will attempt to fill these in with references.

2:29 Lead in: Flight of the Conchords. \"The Humans are Dead\"

Binary solo:

0000001

00000011

0000001

00000011

0000001

0000001

0000001

0000001

2:31 \"In the know\" segment:

Brad: Our goal is to breakout. Come up with ideas nobody else has come up with.

This isour first attempt at this with our large group. We'll see what we can do.

Robotic transportation. Robots driving cars. Cars driving themselves.

Train systems already.

Heathrow - pod cars on dedicated track.

What about ordinary roads?

Studying this. Incredibly large numbers around cars.

Think about the future city. Mostly the first world city. But we have people from more chaotic cities.

Wired everywhere.

Gigabits of connectivity everywhere.

Cameras

Sensors everywhere

Data about movement.

Reality could be very different from today.

In 20th century: suburbanization.

Could reverse or become worse.

Got excited about cars driving themselves. Discovered they are REAL.

May have visitor - hisroboticPrius drives him around town.

What is future about it is the legal, ethical battles.

Human beings are terrible drivers.

We kill 40,000 people every year. 1.2 m around the world.

Largest cause of death between childhood diseases and diseases of old age.

Cities session ended with a call for end of traffic accidents.

Transportation safety $230 Bn. Worldwide 2.5% of GDP 8 cents per mile.

Gas is above 8 cents per mile. This cost - your share of the cost of traffic accidents -- was highest.

We spend billions of hours behind the wheel.

Accidents due to inattention, drinking. Robots will NOT have inattention. Won't drink and drive.

60% of land in LA belongs to \"the automobile\"

25% of energy use goes into cars.

Building cars also takes energy.

Onething we replace quickly that we could do something about.

Artificialhorse intelligence. More like a bug. Not a lot of AI. Why people have already done it.

About 5 years ago, the military -

[clip showing how DARPA grand challenge #2 - humans could not keep up with robot driver]

Sponsored contest. Small teams, even individuals. Astounding results.

First contest, no one made it 7 miles.

Some of these went 150 miles.

[another vido - cars goes down ravine]

That was 2005. Main sensor broke and car still worked.

What does it mean for how we live? for safety? for our cities?

Third contest was to go on streets -

[video of self driving car with some rock guitar backing BOSS

Ubuntu LINUX.

Terabyte of storage.

Monitor to debug things.

Inertial system.

\"How does itkeep from running over dog?\" Laser.

\"Complicated?\" Started about a year and a half ago.

Maybe by 2020you will be able to buy this.

Get from place to place without having to worry about it.]

18 months to build a revolution with a small team.

Dangerous to predict when a technology will arrive.

I want to tell you that you can alreadybuy cars that automatically park themselves, keep fixed spacing, tells you what car is near -- for lane changes, spotting pedestrians, read road signs, find timing of stop lights, parking garage pillar avoidance. Can save 100,000s of lives

Elimiate importation of oil

: Ulitimate, non-killer app.

This is a way for softare to save the world.

Here is the autonomous Prius. Fisherman's Wharf to Oakland without touching the wheel.

Not science fiction.

Push button on cell phone.

Get car in seconds.

Arrive at elevator of building you are going to - without centralized intervention.

Ability to go in \"right vehicle for trip.\" SUV for skiing. More than one child: minivan.

Vast majority of trips are 1 person, short distance rips.

Energy efficnet. Greener than transit.

In BTUs (unit of energy used in US, not Britain),

People in car: 1.5 (the half person is in the trunk) 3400 BTU/passenger mile.

Buses use more - on average. Not all are full.

Results in US - not as good as Europe and Asia.

NYC system is only a bit better than cars.

Japan is twice as good.

Electric scooter is 10x as good.

Amazing to see

500-600 lbs of weight per passenger. Start and stopall the time.

Not able to compete with lightweight vehicles.

If robots could make us tolerate electric cars, that would be great.

If lighter, much more efficinet.

Movie, \"Who killed the electric car?\"

Long time to recharge. Hard to find place to charge.

What if we had people use standard batteries.

We CAN build theese vehicles. Harder to get people to use them.

This is a chance to apply Moore's Law to Transportation

Competing innovators vs 19 C

Compare: Early adopters vs municipal gov. admin.

Big infrastructures vs bottom-up growth with almost no new infrastructure

Individuals buy the cars - happens amorphously - ground swell - rather than a whole new network with planning and infrastructure - if you allow people to ride on the existing infrastructure - people can ride on that!

It begins in expensive vehicles

but what costs $10,000 today - will cost $100 in ten years

Down the road you will be able to buy a car, that if you are going to enter an accident, the safest thing will be to let go of the wheel and let the robotics take over.

one test - school of fish - do you succeed in touching the fish in a school? No! They manouver out of the way.

Steps along the way:

-existing technology

-safer car

-valet parking

-\"whistlecar\"

-autopilots

-school of fish

-safety contest

Nice to have a race between humans and robots to see who can drive more safely.[Kind of a Turing test for robotic cars, in a sense.]

[video Valet car prototype] parking itself

Two small lasers, downloads maps, drives itself and parks. Technology available in labs. Available in the future.

Whistlecar:

some speed is slow enough to be safe

some special roads with decent speed

slow in the last mile...

Political issues:

must be legal

must not be over-regulated

juristictions will compete

Signapore, China, India, Israel, Japan possibly?

Children, the aged, the drunk?

Downsides:

No walking

Longer trips, Robo-RV, super-sprawl

Computer intrution, bugs

Sometimes when we are given an efficiency or benefit, we eat it up and exploit it. i.e. anti-locking brakes giving people a false sence of security and people taking undue risks.

There are already a great deal of computers in your car, and your life does depend on them but they are not as prevelant as what we are suggesting.

Privacy

Cameras and sensors are everywhere...

Freedom:

Can we oder our robocar to do something illegal?

Will police have the power to redirect it?

WIll the police ever have the grounds to pull you over?

Will you have the freedom to tinker?

New traffic code: - Be safe - Don't unfairly impede others

Example. Tom Cruise in the film (Robocop?)

More downsides:

abuse of robocar avoidance

sourcing the electricity

Arrrgh! (pirates!)

Killbots (Military asks for this technology and built this for killing purposes. Land robots and air predator drones already exist)

Slow cars and empty vehicles moves

Disruption - economic and cultural - positive and negative

Barriers:

Law

Fear

Liability

Regulators

Terrorists

S.M.O.P (small matter of programming - ironic comment)

Software recalls

Police may want to control all the vehicles etc.

Engineering changes:

range not a factor

acceleration and speed not a factor

comfort i.e. syncronisation with the traffic lights, soft rides

sharability

different dafety constraints

small widths, single passenger or face-to-face, sleepers, RVs

Deliverables:

consequence of the military developing this technology - they have made a committment 1/3 of all vehicles will be autonomous - air, land (and sea?) for delivery

If they are used only for cargo - these robots could change the nature of our cities via shopping for instance. i.e. pizza delivery or general shopping. Imagine being able to get anything in a short amount of time. How is that going to change urban design. Retail outlets? Our homes and activities? All of these things can be obtained on demand...

This is something that will be possible with delivery robots. e.g. Meals delivered by robots changing the economics of what we keep in the house, how we use our time etc.

How could this technology change at airports? Robots greeting you at arrival and delivers your luggage. Farms would change with this technology...

Parking and congestion

They do not park - they stand

Can stand in the driveway

Q: If it's using the reflection of the laser to determine the distance of the object why would a mirror make it not work?

Poor Man's teleporter

- Con

What are existing cities going to do?

What can a brand new city do?

Sketch/collage of talk: http://bit.ly/akjPM2

[end of presentation]

All Our Ideas crowdsourced questions: /gsp10ncscore

Please take 2 minutes to vote for suggestions.

Instant Evaluation:

/gsp10/feedback/week-2

Projects:

===========================================

Roads:

Links:

Skytran

/wiki/SkyTran

SkyTran: the future of transportation

Local company aims to build its 'SkyTran' at NASA Research Park

/news/show_story.php?id=1423

$295.54 EZIP 750 Front Suspension Long-Range Electric Scooter

/ip/EZIP-750-Front-Suspension-Long-Range-Electric-Scooter/10737229

/

Futuristic car design

/projects_mobility_bub.html

Global market outlook for electrical scooters

/assets/GlobalMarketScooter.ppt

(copy in Google docs: /present/edit?id=0AXBeYKoQJeyQZGRxMjJnNWpfMjhoczg4dndkag&hl=en )

JCDecaux bicycle sharing

/en/Newsroom/Archives/2010/JCDecaux-renews-and-extends-its-street-furniture-and-self-service-bicycle-contract-with-Valencia-for-a-20-year-period

(copy at /fileview?id=0B3BeYKoQJeyQNTI2YjVlODUtNTNlNi00OTk3LWE0ZWEtYmM1MmUyMjE3NzMw&hl=en )

Electric tricycle $990 on EBay

/fileview?id=0B3BeYKoQJeyQNjM1ODIwZTgtNTkxZi00MTIwLTk2MjUtOGRjNjM0YjRiMmUz&hl=en

=======================

Robot Rickshaw

- effective for elderly

"

/core-Jun29-NCS-CL1-it

"Marted\u00ec

2010/06/29

90-10

Brad Templeton / Salim Ismail

NCS CL1 delle reti e dell'informazione

slide di presentazione: /slides/singu-intro.ppt

Tutte le nostre idee crowdsourced domande: /gsp10ncscl1

[Networking for Dummies Libri:] /store/Computers-Internet/Networking.html

\x3cnotes inizio qui>

[fine della presentazione]

Tutte le nostre idee crowdsourced domande: /gsp10ncscl1

Si prega di prendere 2 minuti per votare per i suggerimenti.

"

/core-Jul15-MED

"7/15/2010

Thursday

2:30-3:15

Philip Low PhD, Founder of NeuroVigil Will speak on novel Neuromonitoring technology and computational biometrics.

Audio: http://bit.ly/axZUn8

I/ SPEARS

II/ iBrain

III/ biomarkers

3:15-4:15pm

Andrew Kogelnik MD PhD (Founder of The Open Medicine Institute). The present and future of clinical diagnostics and medical informatics.

Slides: http://bit.ly/9skPmL

4:30-5:15pm

Keith Murphy, CEO of Organovo The future of 3-D Organ Printing

Slides: http://bit.ly/9CCck3

5:15-6:15pm

William Haseltine, PhD Chairman of Haseltine Global Health. Bill is a former Harvard prof, and a very significant figure in Biotech, including founding Human Genome Sciences with Craig Venter.

Dr Haseltine will speak on challenges and opportunities in developing/commercializing new technologies in healthcare & biotechnology.

=============== PRE-presentation notes

Erez has introduced a new SUMMARY Etherpad:

/Pad-One-Liner:

Please contribute.

Spreadsheet of all core Etherpads:

http://bit.ly/GSP10library

Link to full SU Etherpad index:

/gsp10pads/

PRIOR MED pads:

/core-Jul01-MED

/core-Jul8-MED

/core-Jul8-MED-afternoon

=============== End of PRE-presentation notes

2:36 Daniel: Intro

Philip Low: Have you had your blood pressure checked?

Your brain?

- Painting - George Seurat

http://www.artic.edu/artaccess/AA_Impressionist/images/seurat_lg.jpg

Revolutionary painting. Put microscopic dots on canvas to make this painting.

We can understand the different figures.

If you take a few steps closer, we lose detail. Just a bunch of dots.

Why is this important.

- Spikes

Used to representing things in terms of dots in neuroscience.

When cell fires, we get dots. Repeat over and over.

Cell tends to fire at pretty much the same time.

Neurons are responding in reliable, reproduceable fashion.

More cells in our brains than stars in the Universe.

- EEG

/wiki/Electroencephalography

Heiroglyph of the brain.

/wiki/Heiroglyphs

Very hard to decode

Brain is not on or off. This is an analog signal.

How can we present it as something less abstruse.

REM sleep - around head near eyes that tell us about this sleep.

Can we do this [find patterns?] with the brain.

Three parts.

I. SPEARS

II. iBrain - sort of an iPod for the brain

III Biomarkers - what kind of biomarkers can we get non envasively and remotely (not in a clinic)

- Yearly Cost

$25K Alzheimers patient

- $100 B for Alz

$42 B for Schiz

/wiki/Schizophrenia

Strong link between sleep and schizophrenia

- \"increased insomnia\"

/wiki/Insomnia

Sleep apnea

/wiki/Sleep_apnea

Amount of sleep - we've lost 20% of our sleep.

1 in 6 say severe problem.

Half of all auto fatalities caused by people falling asleep

/wiki/Car_accident#Causes

/wiki/Sleep_deprived_driving

70 million Americans have a sleep disorder

4 million get sleep tests

why don't more people get tests? current system sucks

-

1 in 3 americans claim sleep is a problem

1 in 6 says it's a severe problem

1/3 of accidents on the road are due to falling asleep

1/2 of fataliites on the road are due to it

-

What is a sleep test?

polysomnography

EEG, blood pressure, oxygen saturation, heart beat, etc.

Takes about two hours to set up and by the end have about \"400 electrodes hanging from you\" - Luke

Electrode placement process:

rub skin with abrasive skin glue suction cups containing sensors then duct tape them

about 22 wires

/wiki/Polysomnography

-

/wiki/Polysomnography#Interpretation

-

So that's the way we record sleep in 2010

How do we treat sleep?

/wiki/Sleep_medicine

Have you heard of Haclion?

http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0000809

-

It was the ambien of late 80s early 90s

It made people nutz

/wiki/Triazolam#Side-effects

Makes the problem worse

-

example: Woman killed her mother before her mother's 83rd birthday put the card in her hand and won a settlement against drug maker

-

Do you own an MRI?

-

Super Computer?

-

Cell phone?

Let's use cell phones for our studies

-

Going back to the study let's focus on a single channel

Let's do some analysis, from my work at Salk

I initially started on Birds, if you look at a bird brain it is very different than a mammalian brain

bundles of neurons that are highly specialized, very well pattern defined when bird is singing identical when they are sleeping

Invented a method to record and an algortihm to analyze

-

alanyzed rats, birds, lets do humans

-

usually don't see anything over 20 Hz even though we know the brain can do it, call above 20 Hz \"dark matter\"

normalizing data allows you to see higher frequencies with low amplitude relative to their low frequency high amplitude counterparts

-

Take all the labels and super impose them on the map

-

Who thinks REM is red? etc.

Red is Rem

White is sws

blue light sleep

yellow wakefullness

/wiki/Segmented_sleep

-

with german data the same trick works

interesting because it means we can go from 30 second snapshots to a single dot and we can create an entire map of sleep using clusters of those dots

-

Separation Clusters

how many groups? 4

3d graphs using: w filter, sws filter, rem filter, time filter, etc

-

we have great ways of looking at the info but still need a better way to test

-

so this is where the iBrain comes in

/ibrain/

-

User friendly on off switch, easy electrodes, washable, secure, HIPAA compliant, 60+ hours of recording storage, USB or wall chargeeable, rechargeable 20+ hours of battery life

you get fairly clean EEGs

-

Go from big guy with all these wires and a graph to sleeping beauty with analyzing down in under a minute

-

Here is the team

-

here is the science board

-

business board

/leadership/

-

which parts of brain causes which sleep patterns?

thymus = sws

etc, etc, etc.

/wiki/Thalmus

/wiki/Hippocampus

-

Chart: Frequency Separation over Time

What do you see on this chart?

Red dots have two levels

-

If we looks at just rem and remove all the colors

do you think this is automated or same subjects on two different nights

-

arruban dolls made when children with special powers die so the sibling can take care of him/her, special powers = twins

-

neither I am showing you twins

-

-

looking for partners around the world

-

X prize for a alzheimers diagnoses algorithms

-

get same sensor readings through shirt

-

\"We shall not cease from exploration, and the end of all our exploring will be to arrive where we started and know the place for the first time. \"

T. S. Eliot

I am only one of many, thank you

Q: Biggest task of using a single channel EEG?

A: Convincing people that all we need in most studies is a single channel EEG

Q: What are you doing with Pharma?

A: Take the drug and send the patient off to home to use drug and sleep sensors, we don't know what drug they are on and we look for changes in brain

we test before, during, after

Phase 1: look for safety of drug

Phase 2: look for efficacy of drug compared to controls

Q: Why were there studies with multiple channel EEG and not one?

A: It was thought that we needed multiple reading to understand patient was undergoing REM

Q: Compared to competitor[which one anyone]?

A: We are different, can't really talk about what they are doing, they are trying to show people their current brain patterns, we are creating a map of brain based on your sleep

Q: DB?

A: We want to build the biggest db for the brain

Contact

7606 Fay Avenue

La Jolla, CA 92037

USA

T +1(858) 454-5134

F +1(858) 454-5164

530 University Avenue

Palo Alto, CA 94301

USA

By Appointment Only

info@

3:34 [Julielynn gets wired up and brain waves are displayed on iPhone]

Daniel: Thank Dr. Low.

Salim: Quick update. In DC. On the worst days to leave SU for the summer. Strategy US-AID $120 b budget. How do they structure themselves for the future.

aid.gov/about_usaid/

By end - participated in grand dinner. Hillary Clinton gave a talk.

Standing at the grand podium - for 4 minutes talked about SU.

We are way ahead of everybody else.

How quickly can we have followups with you.

Pretty profound day and a half.

Great solutions come when you are playing with it.

Orthogonal turns.

Speed with which you can iterate with goal in mind is what gets you there.

Have fun with it.

Think of each of these lectures as fun, in a sense.

Talks off the main track.

Far out, outlier idea. How would I use this in synthetic biology.

Have peripheral talks, little clouds, something interesting will come of it.

Luke is here for a few days. Major pain in ass last year. Extraordinary.

Luke: Quick announcement. Sarah Jane Pell. TED Fellowship. Deadline Aug 20. Will talk late tonight, ad lib. Really good idea to have video on-line about you talking about your passion.

Friday night - record that.

3:45

Andrew Kogelnik

andy@o

Where diagnostic testing

- Overview

Historical

Current

Real World and Future

Summary

Often a void of data being returned to you.

- History

Ear to chest ... Koch, isolate microbes ... radiology

In last 50 years, have moved along.

Biotech DNA, messages

A lot has not translated well into clinical practice

1960s were first regular blood tests

PCR in 1980s. Now full genome sequencing.

(under 100 people)

Clinical medicine is not geared to figuring these things out.

Data / Physician -- gap -- how to leverage genome, testing like iBrain.

Would love to hook iBrain up to patients.

- Diagnosis and the Elephant.

X disease and here is the chromosome

-Sensitivity vs. Specificity

[ see also

Moving beyond sensitivity and

specificity: using likelihood ratios to

help interpret diagnostic tests

/upload/pdf/issues/107.pdf#page=15 ]

-ROC Curves

-Nosology

/wiki/Nosology

the study of classifying diseases

doesn't do much when we are at molecular level

- Blood Diagnostics

diagram of cell seperation tube (plasma, cellular band, gel, RBCs and granulocytes)

based on where you simple (blood vs tissue or much more granular than that) you may find different results

you have to make sure you are talking about the same thing hen you get down to that level

/wiki/Microbiology

/wiki/Virology

/wiki/Cytogenetics

/wiki/Fluorescent_in_situ_hybridization (FISH)

- Convergence

Databases

- Examples. Biotech vs Clinical Medicine

-Dx Summary

treatments for ? and typhoid fever are very very different

and we can give them the right treatment on day one which could be life or death for these patients

-

You can find individual gene responses on this graph over time and type

See different responses in staff vs. viral infection

-

shortcuts this pathway

- Future of Diagnostics

where are we going with this?

is there a unique RNA or molecule for a particular disease

I may not be able to culture the specimen

It's possible to find molecular reaction to treatments

andy@o

4:20 [applause]

Peter D: Singularity Ring Options

New developments

Kip will have ring sizer

8 like A

22 like B (with rocket)

4:38 Keith Murphy

organovo

Regenerative Medicine in Three Dimensions

Daniel: The last part of our medicine track.

Cutting edge work - coming to clinical reality

KM: Thanks Daniel.

I understand you have seen a lot of 3D printing.

Excited to talk about the biology part of that

cells need sterility so couldn't bring a demo

but I brought some slides:

- TIME magazine. Alexis Carrel.

Invented way to connect two blood vessels.

Joined with Charles Lindbergh

Developed large perfusion system

Lindbergh had material science background and developed the pump

Able to perfuse a chicken heart and keep it alive for multiple weeks

seen as engendering life, capturing the secrets of life

- The Early Years and Successful Skin Tissue Engineering

Organogenesis - Living Technology

Apligraf from Advanced Tissue Sciences - $100 m raised, then liquidated

Generation of life has proved much harder

we are at 2D tissue generation

Created skin successfully to give to patients but it is hard to do succesfully

Advanced Tissue Sciences is now out of business because they were too widespread in their ims and only had one skin product in one market

Then Organogenesis narrowed their focus but also went backrupt

You've got to have science matched with -- in medicine -- reimbursement.

Novartis - expert in getting paid.

- Engineering the Third Dimension Tissue Engineering

[book: Principles of Tissue Engineering] [ref]

[photo of mouse with ear growing out of its side - the ear-mouse]

2D is where we have had our successes but their have been a lot of attempts at 3D

printing construct in a 3D printing way then grow cells in that collagen structure

- Successful 3D Organ Generation

Grew a ear on a mouse with the idea of transplanting it to a human, for cosmetic purposes not functional

fRom an engineering point of view, build the structure, grow tissue on structure, add blood vessels so the cell don't die, erroding the support structure at the right rate, ...

Tengion via Anthony Atala developed a bladder-esque device made of smooth muscles, huge success, in phase 2, works in some patients not others but still a breakthrough even if it is still in 2D space

- Decellularization of Organs Shows Initial Promise

Another concept: instead of creating a scaffold structure, take something from the body and create the scaffold from that. This is called decellularization. Anthony [?]

Anthony Atala works on this a lot.

Doris Taylor at U. Minnesota

This has only been done in animals for obvious reasons. Strip organ of cells, usually with a basic solution that will wash away the cells. What you're left with is the collagen matrix.

You can actually get the cells you put on that structure to beat. The challenge is getting it to last long-term and be effective.

Another example - in the lung - published 4 or 5 weeks ago. She took a similar tack and used it on the lung. The time frame was very well documented - it lasted 45 minutes to 2 hours. This leads me to another big challenge in the field. You can create something 3D in cells, maybe even with a biofactory, but if you do that, how do you get the cells to remain alive? That's the role of the vascular system. One of the goals of this strategy is starting with that - one of the hardest things for anyone to do. You can put these cells back in the body, but they're outside the collagen matrix and blood vessels are on the inside, so they're starved of blood and die in about 2 hours.

With Organovo printing technology, we can make a 1cm cube of liver cells, but the cells in the middle will die in 2 hours.

we are not at the point where we can print an organ yet

- Inkjet technologies Developed by Thomas Boland at Clemson

One of the important things is to distinguish what we do - organovo - from inkjet. Inkjet is just taking a regular HP inkjet and find way to make the orifice work so the cells will spray out and stick to a surface. It can be as little as 1 cell at a time. Can be good for testing - 96-well plate, etc....

If I can print one layer of cells, and then another layer, and then a third, can I get to the point where I'm making a structure. You guys get that because you've been playing with the 3D printers.

They [who?] have re-engineered their HP printer so it has a 3rd axis stage. They're using a combination of collagen and cells to print their structures and get to 3 dimensions.

- Organovo Story - NovoGen Tissue Printing

Organovo has a similar technology to that, but we're trying to break through the traditional scaffold-based tissue engineering.

Tangent: I'm a chemical engineer by training. I was studying drug delivery at MIT. A Bob Langer technology, encapsulating proteins. Moved to Amgen, went to B-school, but I had the background in that tech and a real drive to be entrepreneurial. i went out and looked for a technology that could essentially do this - 10^9 - be really big. I had to good fortune to get introduced to [??] at Unive. Missouri. He didn't get the attention from the VCs there. I connected with him, he knew he wanted to get this commercial, but we formed a very good team. I'm coming from business, he's coming from the scientific side. I wanted to be back 20 years before, at the dawn of biotech. I was able to grow with that. Thinking about where that took me, it was obvious I wanted to be in regenerative medicine.

Tissue culture is so well-defined and commonly used that people have even forgotten what happens in tissue culture. They don't think about what's going on in the system. They say \"you can't culture liver cells. They don't grow in culture.\" I look at it from an entirely different perspective. They grow in the body. We're just not transferring the right abstraction to allow them to grow outside the body. The same thing is true of liver cells, eyelet cells. People say \"we can't do diabetes because you can't grow those cells outside the body to test them.\" But they're just not creating the right environment. Some time ago people said you couldn't make smooth muscle cells outside the body. Well, our EVP of R&D was responsible for a breakthrough in that field. She showed everything done in cell culture involved turning on the incubator, creating a temperature, CO2 environment, and you're done. Well, there's a key gas you're not thinking about, which is Oxygen. What's the composition of air? 79% Nitrogen, 20% Oxygen, and the rest is Argon.

/chemistry/aircomp.htm

What percent of oxygen is seen by the average cell in your body? In the blood flowing through the arteries, it's about 5-12%. Completely different from 20% in ambient air.

Many of us take anti-oxidants. Oxidative stress is one of the major causes of aging. So when you're sitting with these cell cultures in a high-oxygen environment, you're causing them to die faster.

That's the kind of breakthrough thinking we like to build at Organovo.

Let's talk about Novagen. It's not inkjet. From the earlier talk we saw Pointillism. Think about your TV, computer..it's creating a 2D image out of tiny pixels of color. You can just do color by numbers and Serrat can just put those little tiny dots there. Organovo is doing that but instead of colors, cells. Make that 3D grid very small, so they're each comprised of just one cell type. You put those cells in those places - you're not done, but you're on the way. Our cartridge is filled with tiny spheres of cells. 100-500 microns in size. Thousands of cells. What is proprietary about what we do is making those cell aggregates. Intermediates that survive printing, but fuse into a greater structure. The way it works - what's the - uh - MakerBot. MakerBot prints two materials, positive and negative. We do the same. We print the cells as the positive, the negative is a gel that the cells have no affinity for. Then we wash away the gel. There's a gel head and a cell head.

In this picture, the tiny orange balls are cells. (They're not actually orange.) The grey is the gel material. We just lay these two down next to each other with high precision. It doesn't have to be hexagonal, but it tends to line up that way. You can actually imagine if you look at the bottom right, branched structures. That's important to solve that problem I was talking about before - vascularisation. To make this a real transformational tech, we need branch structures and blood vessels.

- NovoGen Bioprinting Explained

[video]

We take cells, and then recombine them...here, in this one you'll see the cells are initially cylinders. The intermediate after printing...and then that's the finished product after incubation for 24 hours.

Essentially, what you saw is that in some cases we don't need to start with spheres. If you know you have a constant cross-section, may as well start with cylinders so you don't have to fuse in an extra direction.

- After Printing, Blood Vessels Are Matured in Bioreactors

What you have to do with this afterwards - the downstream challenges really start to cause us problems. You have to keep that tissue alive. And what environment do I have to put it in before it's ready to go in a body. As soon as it's fused, we need to start maturing it because it's not strong enough right away. The burst pressure is going to be 0 right away. At 24 hours, it's going to be 5 mmHg. So that's about 1/24 of the pressure we need. At day 4, it's 360 mmHg. In the body it's 1500 mmHg. What's going on in that interim that makes that happen? Connective tissue. If you take a picture of your body, if you think about what's inside, there's only two things fundamentally. Cells and collagen. There are different variations of collagen, we call them the extracellular matrix. Cells bind to those by tethers that they put out from the cell membrane. And where I'm talking about day 1, what's holding the cells together is those little tethers that stick to each other. It's kind of what happens when your hand sticks to leather or vinyl. The key is that collagen can grow over time, but you have to give the cells the right conditions to grow, in a bioreactor.

These are blood vessels being profused. We give it constant pulsation, at 60 HZ to 168 Hz. It will beat over time. That strengthens it. Largely we're training the muscle to be able to grow. it will strengthen in burst pressure and decrease in compliance. On the right you see the pumps.

- Successful bioprinting of branched cellular tube

I mentioned that one of the challenges is blood vessels in thicker and thicker tissue. This is something else we use the printer for. Here's that schematic - cells as spheres, another layer, and then a top layer, being printed out of spheres. In this case we want to make the branch structure, so not cylinders. it tapers down in diameter, because we're making a macrovasculature. We have made these already. But we haven't shown we can make those grow in tissue and make it work. We have a number of grants - DARPA, SBIR, NIH - but it needs more funding to really get it going.

Our goal is tissue on demand. The concept is, when a surgoen goes to do work inside the body, their palette is very small. They can only work with the tissues available from that body, or a cadaver in some cases. So there are things they can't even dream of doing. Bypass surgery is simply taking a blood vessel from your body, and using it to bypass an artery that's going to the heart. The reason they don't do it very often in your brain is because you don't have the right size blood vessel to work with. The vasculature is going to be the same diameter in some places, but you can't do it in the toes or the brain because you don't have the right size material. Would be solved by tissue on demand. You have a problem with your urinary tract, you want to reroute to a urinary bag, you have to take bowel tissue to do that. We could make a simple tube of smooth muscle, so you wouldn't do further harm in the body.

- NovoGen Bioprinting Techniques Are Also a Platform Technology for Creating More Complex Geometries

We think we can get to things like liver tissue. A kidney is a big filter. A liver is more like a bioactive sponge. Actually performing functions on toxins. A big bed of hepatocytes

/wiki/Hepatocyte

That bed, with four different sets of vessels, the biliary system, two different venal systems and an arterial supply of blood. When you get to printing that you have to break it down into these tiny little grid spaces. When you think about printing at each level, you just take a cross section and print on that 2D layer. You can print a tube with a series of ellipses. The challenge is maturing it and making it work.

- Why Do Cells Fuse Together? Why Do Cells Hold Together?

I want to show you a bit of actual biochemistry in our process. The cells bind to the collagen proteins. They make the collagen themselves - that's at the core of our tech. You don't have to start with a foreign material and attach cells. First place the cells where they need to be, and then if you give them the right signals they know what to do. If you put them in a bioreactor they actually build /wiki/Elastin which is what you need in a blood vessel.

That process starts with our cell aggregates, the building block of the bioprinter. As soon as two cells are put in close proximity, they start to bind through cell adhesion molecules. Then, they have some flowability{?} They're not completely bound. They move by normal tissue liquidity into the shape you wanted, and over time build more and more of these bonds and become a closely bound piece of tissue. Start with weak adhesion, and then build a lot of adhesion. The 3D structure build when these cells are close together causes the collagen to be built.

This happens in your body every day. 60% of your body is not the same as it was 180 days ago. Collagen included. Cells eat away collagen and build new collagen. We're just starting with none and getting to the point of having enough. (Bones work the same way too.)

- How Long will it take?

[bar chart showing Scaffold Based effort totally dominates 3D printing approach]

Success Timing is Entirely Dependent on Funding

Alliance for Regenerative Medicine /

Biggest question we'll get in our field: How long will it take to actually create large organs? And this is where prizes come in. The concept we need to do somehting big as a society to make organs happen. We're a company, we have to be profit-oriented, and what we said we'd do is to be a platform to make the greater good happen. We want to provide our tech broadly. You have a choice, you can do the two things you can fund yourself, or create a platform for everyone, bring in people who know what you don't know, give the tools to the people who can work with them best, and make an iterative process.

What we're trying to do is use these bioprinters we've already created - very easy to use for a researcher - we can literally take them tomorrow to a university, if they have the cabinet where they make cells, it fits inside that same cabinet and they can print something within a week.

A ton of work for 20 years with the scaffold, a tiny bit with bioprinting. Early days here. We're working with groups like the Alliance for Regenerative Medicine to get more funding.

- Click and Print (TM) Technology

Automated calibration - makes things easy. Accuracy +/- 20 microns. Click and print technology: we'll need help from guys like you in the future - our skill set does not include cad-type data. Right now it's a very basic system where we just click this - the blue represents gel, the red and orange represent cell types. You can just click this in - about 60 clicks and then hit print and it will make the structure. But in terms of taking MRI, CT data, turn it into a CAD to make the tissue you want, we're gonna need a lot of help.

Our field, I feel, is one of the most in need of multi-talented people from all different perspectives. Theoretical physics, biophysics, anaesthesiology, developmental, zoology, cardiac profusionist, industrial automation, biochem. The only way we get to where we're going is blending all these together. That's I think the essence of what the Singularity is about.

So essentially, this is the printer in action - we couldn't bring it in [video]. It's printing a blood vessel. Let's take questions while this plays.

Q: Can you print a brain or a whole body one day?

A: The hardest thing to do is going to be brain. Axon grows very thin and can go for meters. It's going to be hard to print. However it can be done. There's a lot of things in the body you can contemplate making already. Nerves are the hardest. We've got a product that's essentially a nerve conduit. Can't print the axons, but we can print the structure that surround them and then the axons grow. In animals, to reconnect gaps in the periphery, this works. But in the brain it's a mass of neurons, and you're talking about placement of molecules, not cells.

Q: What are the next steps for other areas to focus on?

A: We try to keep things simple - allow the cells to remain alive. Work through the hierarchy - larger tubes, when you get to a certain wall thickness you need to build more blood vessels into the wall. Trachea, bowel - like a large tube - Our wall thicknesses are 500-600 microns. The next level is tubes like 4mm.

Q: What about the other direction? Stopping development? [For cancer?]

A: We're not smart enough - we can give people tools. Talk about testing antiangiogenesis {Angiogenesis is a physiological process involving the growth of new blood vessels from pre-existing vessels.Angiogenesis is a normal and vital process in growth and development. However, it is also a fundamental step in the transition of tumors from a dormant state to a malignant one.}. Can take cells from all different phenotypes, create 10 different tumor types, show that it works on some but not on others, reduce cost of clinical trial. We'd like to sell them into cell biology in a broad sense. Diabetes research, cancer research works the same way.

Q: Chiara. Work in biotech. Really great. Nuclear fusion. 1 cubic centimeter.

A: What i was saying is that I could print it but it wouldn't live. The cells would die.

Q: Just using the profusion through the bioreactor?

A: So, eventually I think we can. But it's about making that branched vasculature first, and then allowing that - flowing through all the branches at once to make the tissue live. Needs to run through capillaries. If it's tissue it's so integrated you can't flow through. Once the cells are bound together, they're impenetrable to the flow. Let's talk more offline.

Q: Justin/Canada. Great stuff. Dozens if not hundreds of hapatocytes? What have you done for anatomy of liver to show different cell types.

A: We know the microarchitecture of the liver. We didn't do that but it's been done. What we rely on is inherent programming in the cells. Our strategy is to use some of the stuff - multipotent stem cells can become all of those different cells, if they're next to the right cell and have the right env't, they will do that. We can print a mixture of endothelial and smooth muscle cells, and we give that flow, they migrate to the lumen.[??] So they know what's going on.

Q: Extreme project by Stelart. Tissue engineered an ear, implanted into his arm. Wire it up so it functions and has hearing. Given extraordinary project? Can you imagine this technology way in the future?

A: I'm gonna back up a couple steps. Does anybody know Dogtown and Z-boys?

/wiki/Dogtown_and_Z-Boys

The guys in the 70s breakthroughs in skateboarding? When I saw that as an engineer, what struck me was the breakthroughs in making skateboards. The grip of the wheels, the ability to flex at the join. Tony Alva was a great skater but he wouldn't have been able to do that without the tech. I don't know the number of things that could be done with this. I fear the number of things that could be done with this - with cosmetic surgery these days, things could go really crazy.

In Belgium they took a cadaver trachea, placed it in the forearm in the patient, taper them off immunosuppressant drugs, and then they were able to implant that in the trachea. There are all sorts of things that people will be able to do. That's the Singularity, I can't see past it!

5:30 [applause]

Daniel: Thank you. New faces, in case anyone needs them.

Another un-ERB approved medical experiment.

Alex and Teguest and Emiliano and Emma Brooke

/wiki/Zyban

Aug 1 is cold turkey day.

Peter: Nice job Daniel.

William Haseltine

[ no slides ]

I thought I'd give a more personal story of what it's like to be involved in transforming fields. I created the first dep't of HIV/AIDS. Got the first significant funding for HIV/AIDS, both private and public. I might sound a little unmodest, but I think my work has laid the foundations for not the cure of AIDS but the control of AIDS. What was I thinking about and how did I proceed?

The first time I heard about AIDS it was called Gay-Related Immunodeficiency. I had two labs, one to support cancer therapy, and another which was following my passion, the possiblity that retrovirus caused human cancer. I had two things going on - one was how to treat cancer better (I think we made a big different to head and neck cancer, chance of survival went from 20% to 80% in 15 years. It was basically cooking, just trying different mixes of things) and at the same time I was working on a quest to see if this virus, a retrovirus, was involved in human disease. I built a very specialized lab, that was capable of working on human retroviruses, which did not exist at the time. We were fortunate that people were handing around money in great big chunks. We were one of 2-3 that applied. Before HIV appeared, we had a lab ready to work on it. As soon as retrovirus involved in human cancer - transmissible leukemia - I immediately began to work on it. What was it that made me think there might be a retrovirus for humans? It came from understanding the viruses in real detail, and a deep desire to make a difference in human health. I thought I should learn as much as I can about science. I looked at the natural world - and I saw in large animals retroviruses would go in, disappear, and then years later show up as cancer or immunodeficiency. I thought the way people were looking, in small animals, it was very different. The first virus that appeared and caused human disease was transmitted from mother to child, through milk, and through blood transfusion. A bit familiar if you know AIDS. When I first heard about AIDS I realized it was immunodeficiency.

/Saturday-Funerals-Unity-Dow/dp/0674050770

[...]personal stories and medical interpretation. Bob Gallow, NIH scientist, involved in discovery of HIV/AIDS. Cattle viruses, sheep viruses. We hyptohesized that HIV was the cause of AIDS. The virus was independently discovered in France and US. And because I'd worked on HTLV1, the leukemia virus, I was in a great position to work on HIV/AIDS.Within six months of that work, ideas we had were being tested in humans. it was pheonomenal how fast that went. It was a systematic exploration of how you can use genomic information to inform drug delivery. Also, we were using the same technology to very quickly;...aids tests. They uses a whole mishmash, and we were able to give them very pure antigen. Able to have a very clear test.

In the early days one of the real problems was false positives. 1 in 300. I had friends who tested false positive. It was not a pretty picture. A couple was planning to move to the US, lived in England. She tested positive. She wasn't able to go with him to the US. It turned out to be a false positive, but it did lasting damage to the relationship.

Go back a little bit to what I was thinking about. I was convinced these viruses caused human disease, based on knowledge and intuition but not fact. It was a guess. The moment AIDS arrived I was there. But something else came from a whole different dimension. I was convinced this was the problem to work on. I transferred the leadership of cancel pharmacology to somebody else and turned my whole lab over to HIV. Why? I had read enough about human behavior, mostly in nonscientific literature...

Guns Germs and Steel

/wiki/Guns_Germs_and_Steel

Diseases in human History

Plays by Gibson [or /wiki/Ibsen ?] ...books about the plague

I knew about these viruses and I could see very clearly that this disease would be the pandemic it would be today. It turns out it was not clear to very many other people. I integrated information about human behavior, literature, the arts, with science.

All the work I've done has never been directed by science itself. Colleagues, brilliant people, Nobel winners, were driven by science itself. Science presents questions, and you can go from there. I never took my direction from that source. I always took it from human health need. That's why I put myself in a hospital, not a university. That's what I was thinking, and when I looked at this virus, there was one other key piece of data. This virus is different from almost all other viruses. Why? This virus goes into your body, and has evolved to be able to live with every sort of immune assault. Any other kind of virus, the immune system goes in, it clears the virus, and you're either done or dead. That's why vaccines work. It's not a shield that prevents infection. You get infected but your immune system can shut it down. It's not a shield, it's a rapid response.

We made a couple measurements of AIDS patients. We'd never seen an immune reactions. People dying had off-the-charts responses to this virus. Both arms of the immune system - antibody and cell-mediated immunity. This virus was evading it. The 2nd Int'l AIDS conference in France, at the end I said, if you think you're going to find a vaccine using any tech we know today, you are wrong. I was literally booed off the stage. First time, last time. The whole community wanted to do what they did for polio. But it was a very simple observation. You just can't do better than what the body was doing, but the virus was evading it.

Once I had those facts - one very startling fact: you would think that if I told you your sex partner had a disease that if you had sex without protection you would die, you would use protection right? What do you think the fraction is? I worked with the Army - they personally counseled couples. \"The person you're having sex with has a lethal disease, you'll get it if you have sex, we can't treat it.\" The answer was 30% used protection. It turns out that in medicine the answer is always 30% of people do what you say they should do. And we saw all those other 70% got infected. You may be interested in a detail - whether anal sex is more of a vector than vaginal sex. No, it's about the same.

...

Putting all those facts together, I projected that by 2010 there would be 50 million people infected in the world. The answer turned out to be 35 million are thought to be infected now and 2.5 million are thought to be dead. How unpopular that projection was! There was a book sponsored by CDC called \"The Myth of Heterosexual AIDS\" basically designed to knock me and others out as experts. I was one of the only people who would speak publicly about this. Once, on Good Morning America, Jane Pauley was sitting there, and they like to surprise you with a different guest. This was a mother who had just taken her 5-year-old kid out of school. So I said to the mother, \"you have other kids?\" \"Yeah I have a 15-year old, 7-year-old.\" \"You should be worried about the 15-year-old who's going to have sex.\" But they didn't like that. The CDC and the HHS were controlled by the Mormons, and they just didn't like the idea that HIV was going to be a heterosexual problem.

[?} did a retrospective. There was only one story we really got wrong. The story of whether it would be a big problem. How did we make that mistake? \"We interviewed 20 scientists. 19 of them said it wouldn't be a problem. 1 of them said it would be a problem. We went with the majority opinion. Dr Hazeltine got it right.\" I wrote them back and said this is a lesson for all young scientists. Scientific truth is not determined by public opinion. Truth is not determined by the majority. If you think it's right, stick to it. If you have good reasons and a firm belief, you might be right. You make a big difference not only by your work [ but by your convictions ]

How do you build an institution? I went around to med school deans and said \"this is going to be a big problem.\" One said yes, most said no. Even the other nobel winning retrovirologists. They would say \"They're good for oncogenes, but they're never going to be an interesting subject.\" Joshua Lederberg said \"you're right. I'm not going to do anything about it, but if the population of New York knew anything they'd come down from Harlem and kill us all.\"

If you want to get science to move one way or another, you have to channel money there. Well, I knew all about how you mobilize money. I was on the boards of many groups - ACS, I'd been on study sections at NIH. What I realized is what we needed was an institution which is very much like the National Cancer Institute. We needed private foundations, high-profile spokespeople, a lot of gov't money...At the time two groups had started private foundations. One around Elizabeth Taylor, one around [?], they got together. I told them our mission should be to put together a special fund that would give people money to start new funds. We gave grants to almost any reputable scientist who said \"i want to have a post doc work on x y or z with respect to AIDS.\" Step 2 was money from the federal gov't. Many people here are probably NGO-oriented. That's a mistake.

Gov't can get things done in a huge way that private orgs can't. To institutionalize you want to change government policy. To give you two examples, the economic miracles in India and China were not caused by NGOs, they were caused by systematic change in gov't policy. Deng Xiaoping 30 years ago in China, and 20 years ago in India. Way more effective than all the NGOs combined.

So what we did with the program was to try to convince the gov't to spend more money. And there I was very fortunate. [Worked with the National Cancer Foundation.] Their whole philosophy was to use their small budget to write legislation. Created Kidney Institute, Cancer Institute, ... back in the days when you could pay Congressmen to do what you wanted. And that's what they did. We got their lobbyists, Elizabeth Taylor and I went to Congress, there needed to be a catalyst, I was on vacation and I read that Rock Hudson had gotten AIDS, and he was being treated in France with a drug that didn't work and someone chartered a 747 to fly him back. it made a big splash. So I immediately went to DC, worked with lobbysists, and in 6 weeks increased the budget from 1 mln to $320 mln for AIDS research.

Once you have that, $260mln of that came from health and $60mln came from military. The consequence was the breast cancer lobby got another $120mln from the military for their research. HIV/AIDS was seen as a male problem. All of a sudden it became worth working on - literally. The same people who pu-pued retroviruses became the major spokesmen of why HIV was important. Money is important, makes a big difference.

Today's budget is in excess of 2bln a year. The net result of that - the whole sort of public thing - I did the same with Princess Diana - holding an HIV baby - and also, by going to visit an HIV hospital - that made a global impression - worked with Valentino in Italy to do the same sort of thing. To serve as examples that HIV was something you could talk about and work with.

Back in the lab, we reduced every piece of the AIDS virus to a form that was easy for a drug company to assay. All the proteins. In the early days, the drug companies - the typical response would be, that's an interesting problem, but I don't have any budget.

The way we addressed that was also something I learned from cancer. We created these projects -triple size grants went to a uni prof if they had a pharma partner that they would give 2/3 of money to. I and other scientists would say \"we'll give you money if you start working on this problem.\" That is how almost all the drug companies got involved. The net result today is that there are probably more drugs for HIV than any other single disease - at least 50. And in combination, they can suppress the virus. It was extremely interesting science.

We had to invent a new vocabulary to describe it. It was exciting in terms of public heatlh, too. A few people made a really big difference. I have to say, we were really helped by the gay community. At first they were really hostile. It didn't happen to me, but people had blood poured on them...it was a tough environment. In one sense it was funny, but if you have blood poured on you, it's not funny.

There were a lot of interesting stories, but from my point of view, it filled what I'd wanted to do in my career, which was to use science to make a difference to human health. I'm very pleased with the way it's worked out. We don't have a cure or a vaccine, and I think we are still decades away, but there is finally a glimmer of hope on how to control the infection. There is a program in Botswana, just now being put together. 7% of adults in Baltimore, Washington and Florida are positive - same pop as in West Africa[?]. If they're positive, treat them immediately. The virus load drops, and people become much less infectios. Combination of male circumcisicon which drops rates by 90% from men to women, combined with [?] has a real chance. That's how syphilis was controlled. Any guess on syphilis prevalance in 1910? 20% of adults in many parts of america had syphilis. It was controlled by test and treat. It's more difficult for HIV because it's a chronic treatment.

http://www.pepfar.gov/

Probably most of you not fans of George W Bush. But probably going to save more lives than anyone else. How much has the US committed to spend to control AIDS in Africa? 60 billion dollars. And you go to many places in Africa, but there are probably about 3 million people being treated every day thanks to George W Bush. And it was his personal decision to do it, and he didn't want to take credit either, he just did it. Human beings are complex. He's probably the last person you would have thought to do that, but he did it. May have been Christian duty, who knows, but the fact is he did it.

In this particular region of Botswana, the political aspiration...the village leaders, the area leaders have all agreed that it's good to do. You can't make people test - not compulsory - but 30% are infected.

Emem: My own opinion is that it's discrimination *not* to test. If you go in to say there's a pain, the first thing they ask is \"when was your last menstrual period?\" The UN has written it down that it's a violation of human rights to ask for a test of HIV.

HIV was an exception in many ways. There were a lot of exceptions. It's fair to argue the ethics of some of those, but in many areas now there are certainly models for how you can effectively treat HIV. If there is a way to damp down the infection, we have learned from Africa what to do in Baltimore, Washington, and Miami. it's really informed the programs for those areas. There is a chance that disease can get controlled.

Next phase of my career. Probably most of you are here because you're restless. You have done one thing and you want to do something else. You're not career track types.

(gap - explained how he moved from HIV/Aids to the human genome)

What is the difference between a liver and a brain?

What are all these parts?

Use recombinant DNA techniques to revolutionize treatment.

Used to be find what was systematically wrong.

organ

to

protein

Now we are overwhelmed

Gene to function rather than function to gene, people thought we were nuts.

Blank pieces in HIV. Knew we could do it. Crank gene through standard procedure and figure out what it did.

Where is it

What does it make

Whole series of things we could do.

Convinced once we had a freezer full of genes.

Craig Venter - difficult person to deal with.

Very creative, really energetic. But we got a hell of a lot done.

There was a VC willing to back this.

You cannot believe everything they say.

This guy was to make money and have a good time.

We promised Venter $75 m.

This VC could only commit $15 m disposable to split between two organizations. I thought this was a tremendous idea.

On sabbatical.

Why should I do this?

My job was to go out and raise the rest of the money. At least $150 m.

Wally Sandrig[?] - whole thing as big picture to one guy.

Head of Sandoz.

Can't sell it one piece at a time. I'm not going to buy it, but that's what I'm going to do.

I will do it, pay $80 m, if I get to be CEO.

Somebody else got the job.

Post at SmithKline.

Brought $120 m.

Sold later - raised $300 m and split that.

So what did we do. Within year and half we had isolated all the messenger RNAs. 90% of what human has. Kept machines cranking.

We knew where they were.

As I envisioned, \"give us 5 cancer cells for X Y ans Z and there they were.\"

We were the villans.

First, it was private. And everybody here is open source.

We were raising money and couldn't be public.

Hand over on proprietary basis to SmithKline.

You could file patent.

Ground then shifted.

Needed to put data out if you wanted money.

Caused schizm

We paid off Venter - he then started work on total human genome.

Any time you have gov't and universities involved, everyone worries about money.

We had found humn genes for a fraction.

Who would pay to get all the junk in between.

When people get worried about 3 million dollars, they get nasty.

First, you create a new tool.

This time, we had opposition, so we had to do it a different way -- opposition in your mind.

We had to find drugs.

Two quick hits: Clone by Phone

?? at Johns Hopkins - inheritable cancer.

He'd narrowed it down to an enzyme. Do you have any in this class?

We consulted Oracle and we had 5.

Within a month we solved a problem people had been working on for many, many years.

Second story. Lipitor beater.

You can have low lipids and still get heart disease.

SKB - lpPLA2 - isolated protein, but could never get gene.

Could never go from protein to gene.

Within minutes of turning on our database, they had the gene.

We were able to bridge that gap. And we did it, and did it.

People are still writing about the failure of genomics.

If you are a young scientist today - you do it the way everybody said was nuts.

If you are raising money- raise as much as you can as fast as you can.

Dot com bubble - in one year I raised $2 bn.

We needed every nickel of it.

It took 16 years to get drug.

We want every option we can get.

Stock fell to 50 cents, from high of $100.

Announced drug for lupus - 50 cents to $30.

Hold on to your options.

\"Subducted options\" - one continent slipped under another.

Worked out because it was a good idea and we got people to back it.

Took advantage of fluctuations to raise lots of money.

Big problems. New venture.

Make discovery more efficient.

Let me say a couple of other things.

What is the dogma? Genomics is not necessarily genetics.

You'll hear about human variation.

Those who are in the field know that has been a spectacular failure.

Almost every gene you find contributes 1-2%.

Answer is 7%. 20 genes. Evolution has worked in such a way that any pool gives you a predisposition.

Even with MULTIPLE genes, it isn't working very well.

You heard a talk on diagnostics. Genetics diagnostics?

Did not use the word INHERITANCE.

I'm going to tell the difference between this tissue and that tissue.

There will be some examples where the inheritance determines the treatment.

Measure what the tissue is actually doing.

If 90% of breast cancer is not inherited, what is it?

I have a friend, daughter diagnosed. Right away, get fresh tissue and grow it.

Find out what protiens are there.

Look at microRNAs. Again expression.

Sequence to find how DNA is ALTERED.

That isn't inheritance.

30-40% heritability. In Science.

Breast cancer.

Marko: 2 studies.

All breast cancer, about 7%.

There are genes you can get 30%.

You do not know how the story will end.

When you do a real experiment you don't know what the outcome will be.

You try something. You do your best.

Doing something new now - health care services.

How do we get all these wonderful medicines to people.

Many people go without care.

Study systems that are applying affordable, in the context where they are, health care.

We are collecting best examples.

This idea - may or may not work - get enough good examples and scale them up. Get people to copy them. Models we have found.

Make best in India become the biggest.

Give very high quality health for about 20% of the cost for what we are doing now.

Mostly management. Number 2, technology.

Together we will be able to transform health services in all countries.

India is place for these experiments.

I am chairman of the board. Claudia.

Gates,

McArthur,

international community - health care systems and delivery.

Number of names for it.

6:39 [applause]

Q: Justin/Canada: presence of biotech cos?

No one to pay doctors.

No financial structure.

On board of one world health [ref]

Off patent drug for lechmaniasis?? - no functioning system to get it to the people.

You've got to build a functioning health care system.

We, together with the Global Fund and others,

if you are a person at the end of the last road - you can be tested for AIDS.

Everyone who has a problem can be put into this network in Botswana.

Pockets like that all over Africa.

Expand for tuber

Fundmental programs - other than education - network of health care providers - from clinic to hospital.

Hold workshops try to find best examples.

Daniel: New tech. How quickly developed. Still takes 1, 2, 3 process with FDS?

You have someone here from the Pink army. That is an interesting way. Internet

Bean Foundation - patients ready and in place.

Internet will allow self-organize patient groups.

Lot of complicated issues. Coordinate pharma and government.

Internet will appreciably speed that up.

Big pharma is failing. Efficiency is dropping by 10x to 15x.

Catastrophic productivity decrease.

Has to be better way.

Were some ways to address that. We had a couple billion. CEO chickened out.

Now we can't pull the money together.

How to restructure the R&D process in the pharma industry.

6:46 [applause]

Daniel: Dinner now.

=============== DURING-presentation notes

Can't stand the colors of Etherpad? Turn them off with Pad Options.

(Note: this changes the color for EVERYONE.)

Color card definitions:

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Link to backchan.nl for questions:

http://singularity.backchan.nl/meetings/view/189

GSP10 Book List:

http://bit.ly/GSP10BookList

=============== POST-presentation notes

Instant Evaluation:

/gsp10/feedback/week-4

/viewform?formkey=dGZadGpDejljY0JaWnRnV2Q1SEdYRGc6MQ

Tonight's pad: /event-Jul15-Genomics

"

/core-Jul2-NT-discussion

"JG/K/CT/JW/A:

Cost might be high due to level of purity we don't normally use.

How do you get 100% pure without high failure rate?

Points: more money needs to go to nanotech research.

3rd revolution - but when

Cost of this technology (in general) is high without nanotech.

In past century, we paid high environmental cost. Stopped PCB and dioxins. We learned it had a high price.

Related question: what is environmental cost of having to generate materials with ultra-high purity. 99.999% pure - hard to do.

If technologies already exist, why not in use?

Who will pay for this?

=====

Justin:

Being able to see individual molecules is important.

Being able to manipulate structures.

Important capability. Ability to monitor will be important.

Scanning microscope can be used to feel around.

Intersting idea - create holographic images.

IBM Almaden - high resolution molecular resonance imaging (MRI) - single atom level.

They've made remarkable progress.

Within several years, you should be able to \"see\" whole structure.

If techniques turn to be correct, we will be able to make remarkable progress.

=====

Eric:

Disruptive potential. Transform things. More than 100x stronger than steel.

A lot of capabilities that are nascent.

Large, complex structures: biology can do this now. We have a lot of biological capabilities advancing rapidly. Genome leads to designer bacteria. Lot of capabilities in non-biological world.

Need a bunch of capabilities together - in about 20 years. With a lot of hand waving.

Some time in the next few decades - depending on investment.

====

Chiara:

Large scale mfg.

Manufacturing food.

Basically provide low cost food production.

Chiara: most striking things for us.

Food production could be critical area. Portions of planet hungry / starving.

Material wants go away.

Concept that we will have material abundance - difficult to hear.

Pretty much for everyone on the planet. Including abundant supply.

====

\":

Interested in food issue.

Solve distribution problem. How healthy?

All food modified with nanotech.

Basic question - synthetic food good for you all your life? Will be a lot of study on that.

You can cheat. Just provide good growing conditions for standard life - tomatos. If you have a properly controlled environment - humidity, sunlight, high CO2. Can provide at low cost.

Reduce acreage by an order of magnitude or more.

If food substance itself is out of bounds, you can still use nanotech.

Stick with natural stuff.

Salim: How many of you have conerns with GM foods?

First point: many modifications already. Dog breeding.

Strains or rice.

In our environment, millions of bacteria trying to kill you all the time.

Chance you will be hurt by something man made is low.

====

Candice/Canada:

Already mentioned ideas.

Upstream/midstream/downstream

Scale up, getting into market. Various applications

medical

enegy

Downstream, not talked about, but once you incorporate nanomaterials, what will happen in the environment. Will we be able to control them. That whole ball of wax.

Implications of nanofactories. Workshop planned to discuss downside.

We want to arrange matters.

Unpleasant. Done pretty good job of getting benefits while avoiding downside.

Analogy. Fire is an advanced technology. Very dangerous. How do you deal with it.

Fire departments

Fire extinguishers.

Advantages:

Cooking

Heating

Industrial processes.

We would not give it up, but have safeguards.

====

Matt:

Cost of assembly.

How do you get atoms to bond correctly.

Temperature is not going to be a problem. You look at thermal noise.

Concerned about side reactions - undesired.

Simplest thing is to lower temperature.

Would need liquid nitrogen environment.

If you work harder, could find more tolerant systems.

Figure out what side reactions would be.

Room temp operation will be standard.

Another thing, not brought up. Very energy intensive processes. Many very wasteful of energy. As time goes by, there will be less energy intensive versions.

These things will not be that expensive.

If biology can do it, we ought be able to do something similar.

Probably a lot lower.

====

Sasha:

Implication - engineering one. Build things in an optimal way.

Will that be a natural progression of tools to build tools to build tools to build tools.

Will we continue in an optimal cost way?

Will have general purpose tools building more special purpose tools.

General tools will be atomically precise systems.

Mfg process itself will have assembly lines.

Short answer- most mfg systems will shift over.

Essentially a complete elimination - some will still use traditional techniques.

Molecular techniques may not be best - for example, ham and eggs.

May be simplest.

Probably bulk processes will continue to be used.

Computers will be all nano.

====

David:

Walking army of nano bots.

Things in synthetic cells, cross over to true synthetic - cell looks more and more like molecular manufacture.

I don't know. Basically using biological mechanisms.

Barely to point where we can put in a synthetic genome. Will have extensive redesign of bacteria. Creative leaps. New avenues will open up. Can't see what will happen when money is applied here.

Dry ...

A lot of pressure to use designer bugs to build things.

Whether pressure will bridge gap, then we'll see very interesting designer bugs.

Otherwise, bugs will be over here. Nano independent developments. Perhaps a different track.

Bio systems will top out in performance.

Salim: 5 minute break. Survey - vote for break.

======

======

Second discussion.

Davidad: What are orbitals?

As electron numbers go up, structure becomes more interesting.

You can use those as you want as you are generating the electronic structure, superposition of multiple orbitals. Seems to work well for a variety of systems and approximate structurs.

Salim: Who has a good question.

: Diagram, as energy goes up. What about part of graph where it goes to infinity?

Two protons - fewer electrons between. End up with two positively charged protons looking at each other. Push them together. They get less and less happy.

Carlos: Learned attractive and repulsive. What about affinity and replicators?

So, what is relation between forces and replicators?

Classic von Neuman replicator has a tape. Uses that to execute a series of instrutions.

A biological device - DNA is monomere. Uses 4 bases. Held together by forces I was describing into polymere. That holds information of what is to be built.

Manufacturing device is also held together by forces.

Q: 5 principles. How much does that actually reflect reality. 99%

Yes. We cheat. If you have set of principles which describes some chunk, then confine self to that part of reality well described by the model I have. Design within the constraint of the model. Components will not be well described, but I will avoid those in my design.

One approach, have design rules - flexible enough to cover a lot of territory, but not too hard to wrap your head around.

Misses excited states.

Doesn't deal with computers. Which may use excited states.

We are not dealing with computations, we are manufacturing.

We can BUILD a computer.

Various aspects. We are ignoring a lot of stuff.

Deliberately chosen subset of a much larger domain.

Salim: How could you use nanotechnology to impact 1 bn people?

======

======

11:29 Third discussion.

More efficient batteries.

Solar.

Make food.

Recycle everything.

Applies to all 5 projects.

Develop nanopumps.

/talks/michael_pritchard_invents_a_water_filter.html

===

Dmitry: with these structures, very sturdy - how to recycle? Problem?

What about processing composite materials?

Will we have a problem?

I would not anticipate any fundamental problems. If you want to take things apart.

Space is excellent idea.

===

JulieLynn:

Space Elevator

Upcycling - break down

Water - purification

Energy = more efficient solar panels

Food - synthetic

Yes. Excellent ideas.

===

Justin/Canada:

Decrease dependence on imported oil

Upcycling - use elemental Carbon to build whatever hydrocarbon you want.

Obvious choice would be CO2 in air. Solar energy. Use to recombine Carbon into diamond or whatever you want. CO2 in atmosphere would drop.

===

: Create robotic super-antibodies. Maintenance workers. So we'd all be lot healthier.

Question - we build in macro way, not tearing down at molecular level. Would it take a lot more energy?

Answer depends. Breaking something - say diamond to something with carbon/oxygen bond. Should PRODUCE energy. CO2 + residue + energy output.

Others may require energy input. Depends on efficency.

We should be able to have thermodynamcally reversible processing.

===

Maggie:

Water idea. Collect dew on roof tops.

Water - never ending well.

Sounds good to me.

Removing water fromthe atmosphere - very possible.

Make deserts bloom. Be cautious. If you move a lot of water, you may shift weather patterns.

Obvious solution would be to pump water into the atmosphere. Rathe than building a caanal. Let the atmosphere carry water.

Salim: 2 minutes left. Developments 15-20 years out. What is next? (soon)

Getting nano factories working. Will take awhile.

Lot of interest in nano in broader sense.

Lot leading up to capabilites we are talking about.

Research on small structures.

Seeing people talking about drug delivery.

Seeing other developments.

Thank you Ralph.

[applause]

5 minute break

11:40

"

/core-Jul8-MED-afternoon

"7/8/2010

Thursday

David Bolinsky Video Presentation

\"David Bolinsky\" \x3cdavid@>,

1:45pm \u2013 2:30pm

2:30 -- 5:30 pm

Medical Informatics

Chris Longhurst

Slides: http://bit.ly/9aTPMc

Audio: /leaf?id=0BzeVpIw-GHihY2Q0YmQ5ZDQtMTU2YS00MWQ5LWExYmEtYTgxM2ZkYTU2ODRj&hl=en

Integrative Medicine

Rachel Schneyer

Slides: http://bit.ly/ajjKKf

Audio: /leaf?id=0BzeVpIw-GHihMjZjNTRmNjctZDY4Yy00NTM5LTgxZGYtNzk3MmI2ZjM0YTM0&hl=en

2:14 Buzz Aldrin

Massive changes in short period of time.

Compliment you on your great optimism.

Things in my business slowed down.

Came along at the right time, took advantage.

If not the way they needed to be, we changed them.

Share a variety of different outlooks from many different backgrounds

to make things better.

Recognized as seond leut in war. About your age. Began volunteering.

Quest for big picture. How could I make it a bit better.

Has stood me in pretty good stead.

Look at problems, approaches that might address something I knew something about.

That others weren't that familiar.

Kind of a twist to how you do that.

As a fighter piliot - you eliminate the variables as you can.

Eliminate the problems, then do something you can do something about.

Make corrections.

Typical guidance.

Open my mind to think here we've got different ways for going from one place to another.

Something that went from here to there.

Going to the moon.

There and back.

Operationally useful.

Whatever is doing that is a new entity.

Not that long.

Why not look at Mars. Not that complex.

Way to get to Mars and keep doing that again and again.

Orbital gymnastics. Maybe this might work.

Problem of Not Invented Here. Selling an idea that wasn't invented by someone else.

MIT.

Decided to go to moon. Really big rocket or two Saturn V.

Send two.

The other one, once it gets there, does something else.

Every mission comes back with something that gets landing in the ocean.

Why not have a specialized interplanetary spacecraft.

Why not have it dock with an up and back system.

Orion will be interplanetary craft.

Comes back and aero-captures at the Earth.

After 30 years of landing on a runway, I don't think that was a mistake.

What is cheapest? Land in the ocean. Will we go back to that?

No, land on a runway.

Develop a spacecraft to do that, then sell it to other countries.

These feed into the unified space vision.

What does it unify?

Commercial

Strategy / Security.

Make an overall policy.

Introduce ideas which have just kind of come along to me in the experience realm.

You are trying to do that in a very short period of time. Share with one another in a common task.

Probably going to be one of the opportunities in your life.

Wasn't I lucky to be part of that.

I really wish you well.

[applause]

2:22

Back to work.

Daniel: So, that's a tough act to follow.

I've had a picture on my wall since I was 5.

He was on Apollo 11. Second man to walk on the moon.

Formulas for orbital mechanics.

An architect of that program.

Visioneering. 2-1/2 hours. 8 person panel of extraordinary folks.

40 min with David Bolinsky.

/

/talks/david_bolinsky_animates_a_cell.html

2:24

David: Thanks Daniel.

Best tool of bandwidth aggregation - your eyes.

More information than your eyes.

Much more than you could read in a lifetime.

Mass of information in medicine, technologies increasing exponentially.

Students will be just completely stoppered up.

Need to establish a \"California closet\"

How do you establish a visual vocabulary.

A commonly agreed on thing.

So ideas I am trying to get to you are not something really different.

Approached by Rick Sataba. Extraordinary futurist.

Head of MASH units.

DARPA

Concerned that military was planning to cut non-spearpoint staff, including medics.

Meant greater peril.

Wanted to initiate program where all the technologies using robotics, AI, remote sensing, datastorage, would all be put into environment where soldiers would be followed by intelligent robots, monitor data from soldiers. Autonomously put soldier into robotic uint. Scan the soldier. Automatically do surgical stabilization and tranport. Very expensive.

Problem Rick was having. Years of planning. He had 5 minutes to explain it to Congress.

Big task. So what he asked us to do was to help take 90 seconds of 5 minutes that would show what successful program would look like in an urban combat environment.

[video we saw earlier - viewed through commander's heads up display]

Automatic intubation.

Automatic IV.

Lipstick cameras for remote monitoring.

So Rick was the first PI to get his approach funded.

Lot to be said for storytelling, how you envision the future.

Academically thorough, inject just enough honesty into your piece.

Not promising the world what you can't deliver.

When words fail, this is a great way to get your point across.

How many people \"got it\" with just words?

Interesting things with Health Care reform.

Situation where most physicians and personnel are oversubscribed.

Already hugely put upon. Now mandated to take on additional 50 million patients.

That is not going to work well.

How do we change medical school to quickly educate care givers.

People who understand

patients

care

system

and upgrade system as a whole.

Visual interactive, immersive, active,

Change from show-me based to deeply immersed way.

Things they would find out piecemeal in traditional environment.

Inner life of the cell - Harvard.

So much information to know. Needs to be done differently.

Cinematic techniques. Give students a whole new way to learn.

This was not meant to be seen in public. Meant to show only to experimental study group.

SIGGRAPH submission. Electronic theatre. About a year after YouTube.

Seen now about 11 million times.

How we could change medical education.

Molecular and cellular motion and transport

[video we have seen before - piano music, animated colorful molecular or cellular structures. No text, just visuals. DNA generating proteins. Something squeezing between cell walls]

You can go to the biovisions website at Harvard to see the whole piece.

[applause]

Piece we just finished a couple weeks ago. Kept some of the basic color themes. Made it a bit more ....

[video - violin music this time.]

This is not your father's Krebs cycle.

/watch?v=aCypoN3X7KQ

Because this is below the wavelength of light, we decided to use palette of coral reef.

ATPase.

[applause]

[Video - ad for transgenic goat outputs]

2:46 [Video - stem cells]

One of the interesting things that comes up from having a visual vocabulary is it gets you into areas you would not expect.

[Video - Ad - Dove beauty bar]

2:48

Only way to get public research money and communicate to public health workers and get public to take charge of their own health is to communicate in a sophisticated way. Make them feel they are not being talked down to. Integrate astounding amounts of information. We need to communicate with these people and get a positive feedback loop.

I have other animations, that is a good introduction.

Thank you.

2:50.

Q: Videos online?

A lot we are not allowed to show.

Proprietary.

DARPA piece is only piece in 14 years that we were able to talk about.

Q: Cost?

That was about $90,000/min. Charged to client. Partly because of national broadcast rights.

Typically $35,000/min. Harvard stuff is harder. We use orbital velocity we get out of this stuff to compensate.

Q: Using ?

Different way of doing it. Realtive distance - stereo 3D takes really building a lot more things.

When we do things, we scale it to make is smaller. You eye compensates.

Stereo 3D is coming.

Q: Do you combine raw data?

Protein databank. Take atoms and skin it.

For some scenes up to 300,000 items on screen at once.

We use data when we can.

We are a story driven company.

Q: Great fan. Is there anything you can share as we move on our team projects, power of story telling?

Power of story telling - oldest human endeavor. Oldest \"human\" endeavor. How do you get it into their head. Align your thinking with their thinking. Add to the details. Do what a good committee does - come up with a new hybrid. For all of you who have new things to say, talk to other people. Get perspectives from other disciplines.

You are chimeric.

You are combining professions.

Someone in one alone would never come up with your solutions.

Storytelling is what sticks.

Sasha: Translation issue - maintaining integrity. Tricks to visualize, maintain rigor?

Two different questions. Telling story and making it stick is about giving someone something interesting. Introduce virus into heart and person starts to get sick. This molecule comes in to defeat the virus. This is how it fixes the problem: standard story telling arc.

Something is right, something messes it up, something fixes it.

Slippery slope with regard to facts.

FDA has to see backup research.

Not show questionable things. We try to be really good.

Can show things we can't talk about.

Part is having good moral center when you do the work.

Bryce: bioethics issues storytelling. Stories stick. Gattica. That's what genes mean in the public eye. You want to create -- but not anthromophizing these molecules.

Did Depak Chopra - molecules actively doing things not comfortable for us. They don't act that way. Having a basis for proving that what you are saying is accurate.

We say things in animations that would work for professionals. Civilians would need longer script. Look at tyour audience as well.

Q: What is your take on simple, low tech solutions. Like \"Plain English\"

Daniel told me I had 46 seconds left ...

No problem with quick, to the point. That works as well. Depends on what is your budget.

Any storytelling that works.

3D is our business model Lot of good 2D stuff being done.

Q: 2005. More recently. How much has production cost dropped.

Complexity goes up so cost stays level. Stuff we do now - 500x the computing power now.

People ask for Hi-Def. Lot more scenes per minute. What you are putting in changes it.

Julielynn: Great accuracy. Do you anticipate open sourcing would allow costs to go down?

I hope so. This is all hand made.

Nothing off the shelf and you do it.

Our computers. first cost $300,000. Had to mortage house to get it. Obsolete in 6 months.

Now, something more powerful for $1,500.

Molecules and objects are handmade. We do some programming , membranes to self assemble.

Lot of bespoke work.

Cast members, cast differently.

Keith: Have some demo discs?

Rush up here Walmart style.

Keith: 5 min break.

[pile of students on table with discs]

Q: Have you worked with Massive - AI in each object, like in Avatar?

/

Our budgets are a rounding error on their lunch budget.

XVIVO Scientific Animation

/

====

3:09 Keith. Tried to cover Med School 101 in one hour.

This year, not a lot of time. 12 minutes per speaker.

Pose question. Ask to you - how to use exponential technologies.

Combined panel at end.

45 min breakout. Pick the speaker you might have solutions for.

Robot surgery.

3:11 Kathryn

Augmenting the Surgeons Senses.

Started playing with robots.

combine robots and engineering.

New solutions for minimally invasive surgery.

Problem with open up, fix and move up.

Patient is left with scars.

Minimize damage you do to get in to fix something.

From this [lots of stitches] to this [a few small bandaids]

Robot between hands of surgeon.

Suture is the size of an eyelash.

Can do inside .

Lot of robot.

Lot of robot between eyes and tissue.

Reason why - allows much closer vision of tissue.

Protatectomy (removal of prostate)

Sewing vessel on beating heart.

Repairing mitral valve within heart - without spliting sterum.

In early days, Intutive likened itself unto God. Not modest.

Dexterity

gyno-surgery

Get back to where we could open up and look.

Give back dexterity of hands, vision to be able to see.

In the future, not being satisfied with reflected white light image

but instead making opportunity for camera and screen

to look at spectroscopy of tissue.

Near infrared.

Beyond limits of input organ we've got.

Start to be able to add clinical decision making.

Lymph node.

You learn to say this lump is a node.

But what you reallly want is to be able to look through that tissue.

Marked functionally. Linked to tumor. Dye went and stained downstream - functional connection.

Put dyes in to bloodstream.

See through the tissue. Good connection becomes visible. Functional point of view.

Colon cancer operation.

Dye in blood seen in near infrared - part not lit up starved for blood.

Take out section that is not well perfused and make sure someone does not get a leak.

Binds to kidney, leaves tumor as dark spot.

Squamous cell carcenoma- lights up like christmas tree when you put the dye in .

Cancer is non functional, helps get good margin (space around tumor).

Bile duct - removal of gall bladder. Allows you to see beneath the tissue.

This is bile glowing bright. You can milk along duct. Play around before you clip it.

things I have shown you are al lreally early stage.

FDA approved dyes. Really dumb dyes.

Can see things by way they are metabolized. Into bile. Non of those things targetted.

Antibodies - think dies targetted to myolin sheaths - neurons.

One that finds metastatic cells. They'll light up. Again, look at a state. Not a color. Not a function. You are looking at a state.

Lot of opportunities to desgn molecules.

With very very fine detetion, we'll need something other than white light without greater contrast.

In addition, real time microscopy. Change scale of things we are looking at.

Nerve fibers. Know where they are.

Risk of cluttering screen. Unless useful, just clutter.

- Visual clutter of jet fighter cockpit

- Other inputs?

As we get more and more information. Motivation is very strong.

If we can find out where these cancers are and obliterate them. Things we think of a large surgeries, we can make it more like removing moles. Maintenance mode.

3:24 [applause]

Q: Brad: Tactile feedback?

In robot, crude haptic feedback telling when instruments are colliding.

Big signal to noise ratio.

Suspect information is better than no information.

It need to be PERFECT, not jsut \"good enough\"

Q: Used on brain tumors?

No. 80% of prostatecomy done this way.

Instruments kind of \"throw an elbow\"

Need different kinematics.

Q: How widespread?

1,400 robots worldwide. 2/3 in US. Urology and Gyn.

Q: How remote from surgeon?

Opportunity to be very remote. If too far away timing delays. 200 ms, people tend to osscilate. They overcorrect. Round trip.

Lot of work done for remote telesurgery to space stations and things like that.

Still unnerving when things are slow. Feels like you are underwater.

Advantages of teleoperation not that apparent.

Finding someone who can operate is easy. Finding expert is harder. Get proctor.

That works out better. Rather than high bandwidth of controls.

3:28 Keith: Will stick around. Field trip to intuitive.

3:29

Digitizing the Healthcare System:\u2028Challenges and Opportunities

Chris Longhurst, MD, MS

Chief Medical Information Officer, LPCH

Assistant Professor of Pediatrics, Stanford University

Slides: http://bit.ly/9aTPMc

- IOM, To Err is Human, 1999.

\u201cDespite the cost pressures, liability constraints, resistance to change & other seemingly insurmountable barriers, it is simply not acceptable for patients to be harmed by the same health care system that is supposed to offer healing & comfort.\"

We kill 100,000 with medical errors. About a 747 going down on a daily basis.

Think about on an individual basis.

We've hurt kids.

You can see this order has a problem.

Third order: Morphine sulfate or Magnesium sulfate. Triplicate copy would go to pharmacy.

0.1 gram, we gave full 1 gram dose to preemy baby

To Err Is Human: Building a Safer Health System

Linda T. Kohn, Janet M. Corrigan, and Molla S. Donaldson,

Editors; Committee on Quality of Health Care in America, Institute of Medicine

National Academy Press, Washington D.C. 1999

Josie King, Feb 2001

\u201cStatistics are just human beings with the tears wiped off.\u201d

- EMR Adoption Model

We are stage 2. We want orders to be electronic. Only 2% of hospitals, but 1 in 4 children's hospitals. 500 g to 100 lbs - safety prob lem around dosing.

children's hospitals have more money.

Then bomb dropped

- Pediatrics, December 2005

Computerized Physicians Orders killed more kids.

I'd given up 50% of my career to make this work.

- Pediatrics, May 2010

First manuscript in the world to say electronic records could reduce mortality.

By 20% - that's HUGE.

36 children have lived due to software technology in our hospital.

Media: How do we know you weren't just killing a lot of kids before.

Standard ratio - for every kid we kill ...

Worst in South.

On far left - Stanford. 2008/2009 We've dropped to .45

So again this made the press.

WSJ. Reuters. How come more hospitals haven't done this. What is holding this back?

Observed to Expected Mortality Ratios, 2008

- Barriers to EMR Adoption

Cost is reason.

$600-700 m budget

Cost $55 m to put system in.

IT share doubled.

Next door hospital cost them $180 m . Maybe $250 m - 1/4 of a billion.

How can we commoditize health infomation technology.

Administration said we'll put out incentives.

About as much sense as having children to get a tax break. Does not compute.

How to make software cheaper?

Only one looking at this: Microsoft. Only two verticals - education and health care.

Attempt reverse technology transfer. Figure it out overseas, then bring it back.

Third obstacle:

- Silos of Health Information

Pharmacy,

your health plan.

Health record databanks.

Interoperable. You control it.

Very interesting - bi-directional.

You could aggregate as Google Health [ref]

allows.

Personal records here.

PHR - Personal Health Records.

- Diagnosis Errors \u2013 The Next Frontier

The primary cause of medical malpractice lawsuits is the failure to properly and timely diagnose medical conditions. Often the failure of a doctor, nurse practitioner, or other healthcare provider to recognize telltale signs of disease leads to more serious complications or even death.

The legal doctrine of \"Loss of Chance\" is tightly interwoven with medical diagnosis errors.

-AHRQ, 2007

Diagnosis errors have not begun to be addressed.

Help a billion people and make a billion dollars.

Q: System lives off of inefficiencies.

How do you deal with misaligned incentives - more, not safer, care.

Hospitals operate on very thin margins. HC reform will not thicken those margins.

Will have to figure out how to use system more efficiently.

CFO acknowledges system will pay for itself.

Saving lives does not save us money right now.

Q: Software / Hardware?

Hardware is cheap. HR systems in the cloud. No vendor doing cloud health care.

Yet the market has exploded.

3:42 Daniel Riskin

- The Changing Face of Healthcare Innovation.

Daniel: Kathryn, Chris - incredible work.

I'm the in the trenches guy.

10 years now.

Talk about my background:

President.

One day per week doc.

Develop technology

HC is fun and interesting and you can do it.

HC is intersting field. Big changes.

- scalpel

Started with big incision.

Did impressive operation.

Fast forward a few years and all of sudden laparoscopy is not rare.

Now it is everywhere.

I'm trying to think of new devices.

Entirely different from what I learned to do.

Robots,

new technologies.

Then fMRI.

Devices are incredible.

50% tech, 50% IT - but hard.

Doctor, patient, payer. Government.

Worst inertia you've ever seen.

Great new devices unlikely to be adopted.

We've seen tech kill people - become very conservative.

Get expert feedback.

Trials.

Adoption.

Things have to happen, not always in order.

- Challenges to HC.

Used to do research.

This decade - getting your ideas used.

- Jobs with iPhone

New medical devices which can have massive impact

- Devices, Data and More.

HC IT. Chris - \"cheaper more avliaable\"

Out and available.

Rand $70 bn saved, CBO said nothing saved.

We can devlop infrastructre. Allwe'll develop is technology.

Get devices.

Govet paying to get docs on IT.

80% are private practice. Hospitals are 50% up on HC IT.

Docs are 12%.

Pharma device. Data systems and quality.

Not about the roads.

Building on-line systems. You can't start next EMR company

Use infrastructure. Improve systems, quality.

Move over what Stanford is doing .

All done in the cloud.

Favor quality. Change incentives.

Landscape of innovation you can work into.

Company - wound closure. Being used. Satisfying career.

Doc speaks into iPhone. Gets data in to EMR dirt cheap.

Not that hard. You can do it.

3

BioVisions of Harvard

Switching gears a little bit...

Hearing about this technology, how does this impact us individually? Sometimes theres too much technology

/index.html

Michael McCullough, MD

Just on the phone with daughter who has to decide between removing whole breast....

I speak in accents because I had a head injury as a kid

I am a trauma physcician

I wanted to point out that Moore's law isn't necessarily keeping up in the

Points to Connor: you're heart just stopped...

Points to Julielynn: give him CPR

I'm an ER physcian, the ambulance is here in 4min. Load in 1-2. Nearest hospital in 6. What are the odds?

Excellent CPR, early ambulance... light speed.... What are the odds? 30, 50, 80...%?? You are aggregating on Hollywood's number... actually \x3c1%

The healthiest non-smoker in the world

The average person spend most of healthcare money on last couple months of life with Hollywood expectations. These people cost millions and millions to the healthcare system.

How can we educate people? When people come to teh ER I have to comply... Even if they don't want to be recessitated, I don't know sometimes...

People need to know the data for risks of heart attack, stroke etc...

Some kind of tax incentives for having people say whether or not they want to be recessitated or not.

I think as myself as physcian to increase happiness.

What's your name? Bryce... How many people need to take choloestorol meds... I think I'm healthier taking it?....

One of NGO hats was aggregating how to locate kids for....

I think I figured out how to end affirmative action... 30000 kids in the USA earn a 1300 on SAT but many less go to higher level universities...

Epiphany for college application in junior year of high school

/

Switch to Australian accent...

Q: Sharry: Really only 1%?

A: If your heart actual stops and you have no pulse, it's because the electrial environment isn't correct or aerithmia or.... the only type that you can possibly easily recessitate is if you have air in your chest...

Q: Maggie: Do you ever have any problems where patient says do not recessitate but fmaily says do?

A: I had a patient who hung himself, you could say he wouldn't survive. If he was an organ donor he could help a lot of people. He was African American. Mental sets, sometimes people are prepared to listen to data. You can tell when you hit a wall. I had a patient with swine flu about 5months ago. 29 year old, lungs filled wiht fluid, no insurance. Lung echma (?). He was from hamung tribe (?). Tribe leader didn't want him to. I was able to locate his wife. People are pretty reasonable about half of the time. Most of the time you just want to leave them alone because they're on overload.

Dr Yvonne Kagel

at some point you need to ID center of gravity, no slides

wanted to raise awareness of living / working in micro gravity, long-term and short-term

Space adaptation syndrome: short-term (early space adaptation syndrome)

Human body no longer has force that pulls organs, plasma, blood volume down. The blood volume flows up into head. First couple days foggy head, hard to concentrate, little hard to sleep. Red eyes (congestion). Face looks swollen. Fluid accumulates in inner ear. Fluid accumulates in chest and fills your heart which temporarily becomes larger. First couple days you pee of the fluid and it goes back to normal after kidneys kick in. This leaves you somewhat dehydrated. Your lungs are able to excahnge air better and it's easier and more comfortable to breathe.

After 3 days, other effects. The bones start to demineralize because of decreased loads. Body says it doesn't need it anymore. Bones, stones and groans. Develop kidney stones because you're trying to pee out calcium. Also gets stuck in intestinal tracks. Atrophy of muscles, including your heart. Obdominal doesn't absorb nutrients of medications as well. Early aerithmia, t-wave inversions. Immuno stress, faster expression of disease and possibly types of cancer. Thyroid, risk of radiation expossure. Heart rate isn't as responsive as it used to be. Sleep disturbances, sleep debt. Cercadia shortens.

Deep Space Mars, landing shuttle. Eye hand coordinationa nd balance aren't what they use to be. Bisphosphastes to replace bone density loss in heels and ankles. Enhanced vitamins. Before going to Mars, use stem cells in situ. Games to keep you trained and precise. Simulators where pilots can practice landing onboard space shuttle. Proficiency needs to be maintained. Most successful sign of a good mission is returning both data and the people.

Tethered medical operations for \x3c2weeks.

When you go to moon may be up to 10min delay in communication

Mars, 20min+ delay for communication - problem for deep space if there are medical issues. Need to take all your medical supplies with you.

Tiveon makes a resistive device like a knee brace to give your body resistance.

Sustainability is only half the problem. The other problem is thriving. You wanna feel good! Diversion is really important. Entertainment, humor, curiousity.

Harvey A Fishman

Opptomologist

Novel technologies in cataract surgery

Decided I wanted to be more entrepreneurial

Modern cataract surgery today: all by free-hand. Take a tip,debulk lens, put a new lens inside a big - 2um thick. 100% change of lens at age ~45. As you age it becomes less flexible and yellow.

Cataract surgeons have the highest amount of catecholamines in their urine, because it's a fast surgery (stress hormone - /wikipedia/en/wiki/Catecholamine)

presbyopia - loss of eyesight at age 45, causing a need for reading glasses, due to less stiffness vs. zonular activity

Gettig close to an accomodating lens that would move back and forth via hinges using your eye muscles

Injectable gel that fils the bag in the eye

Polymer based lenses whose shape can be changed after surgery

Smart implants

Femto second laser for much more accurate surgery

/topics/healthcare/articles/91342-fda-approves-first-implantable-miniature-telescope-amd-patients.htm

Game change: femto-second lasers to do the entire surgery. New technology that does every incision. Incredible precision.

Matthew Rabinowitz - Single Cell Genetic Diagnosis: How engineers get Women Pregnant

How do you make measurements on things as small as a cell?

Applied this to the context for making healthy babies...

~2% of babies in US and Europe are IVF

Have a bunch of things you want to test for but technologies that do this from a single cell, you get ~10% misdiagnosis.

Why does a woman have miscarriage? Send fetus in to lab, get lots of contamination. Technology is limited.

Gene screening captures 25% of disease load. 6% of couples in US have a gene you don't want to pass on. Of this, about 5% are increased susceptibility

Pregnant and worrying: 5% false positive. Avoid invasive procedure

1/7 of children who have down syndrome are not diagnosed.

If you have a completely normal fetus, 5% of time you will misdiagnose.

Total available markey, $4.4B in US, $20B worldwide

Result: Parental Support Technology.

Copy cell from embryo, copy number count across all 24 chromosomes. Relable single cell genotype. Use microarray to lay down DNA. Can measure hundreds and hundreds. Also take data from Human Genome Project and microarray measurement from mom and dad. From all this data you can put together all the data from this single cell which alone would be pretty unreliable.

Now can do prenatal diagnosis and determine if there are any copy number errors. 92 labs are now using this.

What have we learned about human embryos?

Disagregated each cell in a group of 8, different chromosome in each cell. Mosaic. Didn't understand how this happens. It turns out that these mosaics are arrising not from sperm or egg errors, but while the embryo are growing in the first three days. 2 copies going into one cell, none going into another. You can track the actual father's chromosome. Really complicated mosaic structure from the first division even.

Improved rate at which embroys implant, 2x (19.7%) implantation rate, 1.5x (21.2%) live birth rate.

PS for Single Gene Testing - can actually measure where teh chromosome cross over happens on single nucleotides at 99.9%. 4^n^10 possibilities where n is base pairs.

Q: Is this a rule that cells don't divide the same in the embryo?

A: The majority of the time the embryo IS mosaic. We believe this doesn't just happen in IBF but also in nature.

Integrative Medicine in Practice

Rachel Schneyer LAc, MS, FABORM

Slides: http://bit.ly/ajjKKf

Rachel Schneyer- Integrative Medicine in Practice

Preventative medicine, lifestyles, how we participate in our health and healing is where the great oppurtunities are.

First trained as botanist

- Indole-3-Carbinol and Cancer

Impact to metabolic pathway via food therapy on disease, such as 1995 study on Brussel sprouts and colon cancer (Nijhoff WA et al, Carcinogenisis. 1995)

Era of Functional Medicine

Determining the outcome of one's health history

MTHFR

errors in folic acid metabolism impact on homosysteine

Superior physician treates the patient in wellness - like in ancient China the doctor was only paid when the patient was well. Inferior physician in disease. We need to incentivize wellness.

Circadian rhythm linke to antioxidant status

Genetic factors

Assimilation/Detoxification

Environmental factors: Epigenetics

Stress assay: Biofeedback, Salivary panels

The Era of Functional Medicine

Some\u2026 carry polymorphisms that are most important in determining the outcome of {one\u2019s} health history. Administration of cofactors to these polymorphic genes can restore activity to normal levels.

Ames et al (Am Journal of Clinical Nutrition. 2002; 75: 616-58.)

MTHFR

Errors in Folic acid metabolism & impact on homocysteine

Low Folate status may lead to cardiovascular events, dementia, increased clotting (cited in miscarriage) and depression.

Prevention as Medicine

\u201cThe Superior Physician treats the patient in wellness,

The Inferior Physician in disease.\u201d

-Nei Jing

\u201cFood for Thought\u201d

How to merge prevention with managed care?

Can technology provide tools to quantify one\u2019s prevention effort?

Elements of Daily Focus

Glycemic Control & Stress Response

Circadian Rhythm (linked to antioxidant status)

Movement as medicine

Influences on Stress

Jacobs GD: The Physiology of mind-body interactions: the stress response and the relaxation response. J Altern Complement Med. 2001.

Acupuncture and Stress

Michael Hollifield et al \u201cAcupuncture for PTSD: A randomnized controlled pilot.\u201d Journal of Nervous and Mental Disease, 2007.

Acupuncture demonstrated as equally useful to cognitive-behavioral therapy.

Applied technology

MRI study demonstrated acupuncture has measurable impact on brain areas known to respond to opiates.

Pariente J. et al. Neuroimage, 25. 1161 - 1167 (2005).

Reproductive Medicine

\u201cChanges in serum cortisol and prolactin associated with acupuncture during IVF\u201d

-Magarellii, PC et al Fertil Sterility 2009.

\u201cBeneficial changes in serum levels of stress hormones while undergoing IVF, with higher rates of pregnancy and live birth\u201d

Integration of Pharma and Herbal medicine

John Chen \u201cChinese Medical Herbology and Pharmacology\u201d

*Details interaction/research validity

NIH funding on Tumeric

Food for Thought

How might data on individual variance reshape patient care?

How can technology provide access to experts, education and social networks?

Chinese Medical Theory

Prenatal Reserves

Clinical Assessment

Qualitative

Elimination diets

Subjective

========

Dieases of meaning.

Symptoms can become catalyst to grow.

Become healthier and wiser.

\"far from equilibrium\"

Static - death.

Body replaces cells within 2 years.

To reorganize, more energy in system.

If you don't change your perspective, you've missed opportunity for growth.

Where can we put our attention where we are aware of resources that allow us to grow or change.

- Somatic Awareness. Bacall [ref]

Internal body sensations.

Culture does not dictate your physiology.

Application for focusing brain on where there is energy. In workshop session.

Thanks for the time.

5:30.

Kieth. If you get a chance to have him do the body work on you, it is great.

One final speaker. D. E. Duncan has another aspect to wrap up entire session.

Duncan: Theme. Really just a few minutes.

What I'm going to talk about briefly.

Effort in experimental man project.

Tried to get every kind of test on the planet.

Been covering for last 10 years - what is in it for all of us.

the Linkage project.

What we hear from eye to IV, pregnancy to functional medicine. All fascinating by themselves.

How do we put them together in ourselves.

Way to big to handle all the details.

Working around country, trying to come up wiht ground work, framework, models that is critical to humans.

Many species do best when they integrate.

Long debate - for 400 years.

Fabulous discoveries.

Figure out how to integrate back into humans. The human organism.

Do some things ourselves.

We have a responsiblity to figure this out.

Also go back to prevalent sense from days when we didn't know much: US. Ourselves.

I'd love to have any of you participate in project from Kaufman foundation [ref]

Policy areas of law, media - as important if not more than science.

We do really well - better than anyone. We can pat ourselves on the back.

Not doing so well, overwhelmed actually - in translating this to rest of society.

Gap between what is being discussed here and discussion in DC about direct genetic testing.

\"Preliminary\" for several years now

What part of gap between innovation and application is natural.

Each technology takes time. FAX created hundred years ago.

Internet invented in 1969.

We can do a lot of structural changes and refocus funding.

End there. Thank you.

Keith: Kind of ending early. 20 min breakouts.

Until 6 pm. Amazing presentation on Skinput.

5:37

[Breakout sessions]

6:15 Dan Morris

Computers have gotten smaller.

The thing we call a computer went from laptop to mobile phone.

This is really different.

Device we compute on has become smaller than keyboard and mouse.

Now playing price in efficiency.

Introduces new research problems.

How to get back bandwidth.

If computers get even smaller, equivalently powerful in a ring.

Half the size of a finger.

Vision pieces - what might a computer look like if it gets smaller and smaller.

What are the right interaction pardigms.

Super tiny computers

Natural evoltion.

Input/output.

How do you talk to a computer that is really realy tiny.

Focus on input.

Let's try to solve this tiny tiny problem by using space.

interact on back of device.

Touch skin input higher.

Super super good touch.

Forget about computer itself, let environment be interface.

Put ring down, scratch or tap on desk.

Other things. Cameras being used.

Others at MS doing this.

Speech reco - totally believe this is in the future.

Let's turn bodies into the interface.

We know it really well.

Eyes free, hands free input.

Turn body into interface.

Computer in your ring. Too small to practically input on.

Specifically muscle computer interfaces.

Skinput - acoustic signals for input.

Q: Weather in Seattle?

Super hot.

Best question so far.

Muscle activity.

200 years of medical applications.

Observed on surface or tiny needles in your skin.

Our unique perspective - what would typical able bodied users use this for.

Tiny arm band.

Watch electrical activity.

Fingers controlled by nerves in the arm.

Even just drinking coffee. Could still recognize gestures you are doing and control your computer.

We asked, is this a useful problem to look at.

EMG measurements.

Regular folks put on device. Could we recognize them?

Pressure?

Move up?

For pretty high accuracy, we can figure out what your fingers are doing.

Now we had $15,000 amp box.

Has all kinds of implications, not a consumer product.

Get rid of wires, gel.

Get rid of hand plopped on table. Make it mobile.

Kind of where we are at now: go from rather expensive gooped up with gel to small wireless radio we have built, sewn into sweat band.

Initial prototype in this space.

This gives you a feel:

[video Wirelss Guitar - sensor on each arm. 2-6 EMG sensors, pieces of metal.]

Get 100% on easy level of Guitar Hero.

Feel for where technology is at.

Q: Did you have to train that on him?

Classic supervised machine learning systems. 2 minutes on you that day.

It works so long as you get it on the same place.

Cross user still to be tested.

We know alot. The world knows alot. We can do better on cross user recognition.

Anyone who tells you sensor is be-all, end-all is just trying to make a buck.

We contribute in this space.

Let each technology complement each other.

Almost all touch sensitive surface has no idea which finger. Good at when/where. Not good at which.

In this video, using same armband, by alternating fingers gives different colors to touch input.

We can also get indication of how hard you are pressing. Reasonable input to ADD TO touch interfaces.

Q: Why is Microsoft so into table?

Our interest - to couple with surface - to complement surface.

Q: Getting signals from

Forearm.

Q: More precise ...

Muscles that control your fingers are in your forearm. Thumb muscles closer to hand.

Acoustic propagation.

Stethoscope is useful.

Can we use that for computer input.

Tapping his arm.

Same video slowed down 14x. Massive ripples down arm. Too fast to easily see.

Into arm and along bone.

If I tap on my hand and arm. Could I look at those mechanical motions and figure out where I am tapping.

Each has acceleromters - 5 -same as washing machine telling you unbalanced load.

Here are three examples - no machine learning needed. They are DIFFERENT.

For quick feel, % correct: as high as 95.5% 10 locations on forearm 81.5%

Subjective feel from [video. Tetris playing by tapping on hand]

What about output?

Q: Andrew: success rate for keystroke errors for people off street?

No technology - including touch - alternatives to keyboard/mouse.

Excellent question. Typo is not a mechanical error. People will make cognitive error.

did they tap where they meant to?

Output side is just as important.

Totally useless if you can't see or hear anything.

Feedback via bluetube headset.

Via projector - on shoulder.

Q: Research it causes on body by holding in certain positions.

Interactions so they are not cumbersome?

Next slide.

Video here. Coupled with projector - shoulder mounted.

Menu on arm. Input/output that goes with me everywhere.

Kind of a vision for how to couple our input with other output.

Can't answer wearability with system in lab.

We want other sensors - accelerometer.

Then find what it is like to wear. Jostled around all day.

Future work.

Q: Alison: Really want to be hired by you to work on that.

Ergonomic and industrial design.

MS has expertise in these areas as well.

What is like to put on/off.

In addition to how can we get computers smaller ...

every time, computers have opened up whole new paradigms.

Who would have thought about texting to meet for movie.

What emerges when you don't have to reach for phone.

Micro interactions.

What is exciting, new.

Pretty wide open.

Sign off there.

/en-us/um/redmond/groups/cue/

Q: How soon?

2-7 years.

How is that for useless range of numbers.

What is demand?

Q: Input. What about display in glasses?

Shoulder mounted example.

Head mounted glasses. No one wants projector that will occlude vision.

Either projectors or displays.

On body displays.

Spiderman pose - display projected in front of me. Device like size of watch.

People say, will never use speech.

Q: Andrew: 5-7 years out. Deploy this sort of technology. May have something requiring no input - something brain-electricity based?

Intelligent people say it will / will not work.

This many non-unintentional bits outs is not going to come from non-invasive brain interface.

Strikes against brain interface:

how much hardware.

Q: Non-invasive EEG.

Current invasive. Still doesn't provide bandwidth.

6:43

Em: tonight Peter's danger talk at 8. Not 7:30.

E-mail 30 min ago regarding Phase 2.

Do no later than Saturday. First come, first serve.

Hey GSPers!

Several of you asked for the contact info for some of the speakers from last Thursday's Medicine track extravaganza.

See list and contact emails below.

**Also don't forget this evenings 6:30 presentation on Longevity and aging by Aubrey DeGrey and Dr. Stephen Coles. 6:30 in the Marshmallow room.

best,

Daniel

--------

Thursday speakers

1. Christopher DeCharms PhD (Neuroscience core lectures) cdecharms@

2. David Ewing Duncan (Experimental Man) david@

3. Catherine Mohr (intuitive surgical, medical robotics) catherine.mohr@

4. Christopher Longhurst (Stanford- electronic medical orders/records) clonghurst@

5. Michael McCullough (Emergency medicine, education) michael@

6. Harvey Fishman (Opthalmology) drfishman@

7. Matthew Rabinowitz, ( Genetic analysis/ in-vitro testing) mrabinowitz@

8. Rachel Shneyer (Acupuncture , integrative medicine) wildflwr100@

9. John Amaral (body work) drjohnamaral@ (*note SU and its faculty does not endorse this field or others in 'alternative medicine'... just thought it might be interesting exposure to what a large population seeks/ utilizes for alternative care :-).

10. Yvonne Cagle (Astronaut, Space Medicine) Yvonne.Cagle@

\"David Bolinsky\" \x3cdavid@>,

"

/core-Jul01-MED

"Thursday

7/1/2010

9am - 11:15am

MED CL1 Intro: Exponential Technologies and Medicine + Medicine 101

Daniel Kraft

Slides: (10 MB pdf)

/fileview?id=0ByuGXnC_X6-QM2RjZTFkZGMtMWYyNi00YTA4LThiMzUtZmI0MmRmZDViMDdh&hl=en

Audio: /leaf?id=0B0vcBiirD3NQMzkxNDBkNjQtZjhlMC00NzM2LTlmYjktNjJmNTQ3MzY3Y2I4&hl=en

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

9:08

Welcome to first Medicine track.

All of medical school in one hour.

Exponential medicine.

How do you measure wellness, disease.

Art of medicine.

All the data becoming available.

Health is part of ecosystem - provider, system, genes/environment.

Never simple.

Framework of contexts [excellent slide]

Definition of health is changing over time.

Providers interacting in different ways - more dispersed.

Year before TED conference -

introduced to Linda. Shared information. Shared information with Harriet.

K1A1B1A

See that shared with Ozzie.

Own Facebook group

Hap(py) t-shirts.

Met through leveraging of cross disciplinary technologies.

Increasing importance of social networking - even in research.

Biology and healthcare also have exponential growth.

Power in the iPhone

Where in another 10 years?

So, rest of talk framed through exp.

Faster/ Smaller / Cheaper / Better.

More and more ability - now in imaging.

What used to take hours, now you have real time fMRI.

With this data, fasted, most complete - look inside his brain/anatomy to look at structure and function.

Beautiful animation derived from the data of his head.

Getting wiring of brain.

What area are active.

Medication to Meditation effects.

Diagnostic tools - PET, CT Scans. Look inside the body.

Let's get personal. Who wants a colonoscopy?

We can dive into the colon. Move through it. Gastroenterologist can see what they would see normally. Augmented with AI.

If they miss leison - AI could say, \"Whoa\" go back take a look.

Doing radiology readings at home in pajamas. Makes other docs jealous.

Virtual hospitals - surgery, patient care

Second Health [ref]

Flight simulators = forced mistakes.

Manidan - challenge the physician.

New era - merging with wirelss technology.

Digital stethoscope - amplify signal. I'll pass this along- you can try it out.

Lub and Dub - you can SEE it.

Send to other physicians. Small example of transformation of simple stehocope

digital stethoscope iphone app

/

IPhone and Android - can do anything we do in medicine.

Cross-referencing color / type drug IDs. Alreay available on pohne.

Most of medicine still based on paper charts.

Mandate for digital health records. 0nly 8% now. Going to 80%.

Powerful inferences from that.

Stream patient data to iPhone. See how patient is doing in ICU (Intensive Care Unit)/

Tradtionally you have to go TO the doctor. Moving now to telemedicine (). Much of care is \"talk therapy\".

Super -Skype.

Billing for that in some places.

Change to interation on-line.

Psychotheragy,

Group Therapy.

Wireless monitoring in the home. Just starting.

Health buddy [ref]

Uploaded to nurse practitioner. If you have a fluid status - in your lungs or to lose weight.

Helped Vetrans by 50%.

How do you feel? Connected to central facility.

EMR - Eletronic Med record

Personal records. If you can't talk or remember. All health care providers linked in.

Drawers whre you can layer information.

Open API (Application Programm Interface)

Digital self-monitoring. \"Body computing\"

Gave talk on measuring you.

Nike in shoe = measuers aspects of your run.

Worried about grandma at home falling - can predict fall, or call 911 if does fall.

Embedded into your clothes. Simple sensors exist today.

If you are in space, you want to be monitored remotely. Not tethered.

CPOD - Crew ...

Motion in 3D sapce.

Field tested in Chile. With Chris McKay. Went diving with it, telemetry of data back to NASA.

Shrunk. Being tested on Zero G plane. Leased to NASA for zero G experiments.

How to prevent space sickness. They call it Vomit Commit for a reason.

Used to have halter monitor. Shrunk - iRhythm. Put on chest for week, put it in the mail, get analysis of your heart rate. /zio-solution/zio-patch/

Quantified Self. Meetup for this at tech museum in San Jose.

/

Look at own health. Own patterns.

New device, Philips DirectLife [/] sensewear / bodymedia /

Slew of these coming onstream.

One major problem is compliance. People don't like to take pills.

Integration into Raisin pill. Patch on back tells family if you took pill.

Zeo device - will be available to try. Monitor sleep. Looks at phases.

Wear a headband. Upload your sleep and hopefully improve them.

Fitbit - flower lights up. (pedometer?)

Hawthorne effect [ref]

If you can share that informtion, trying t lose weight. We'll have scale here.

Uploads your ewight to your Facebook page.

One new integration - watch

Trace you r pulse. Wear strap, not comfortable

Pulse oximetere ?

Should be out in fall - and link to social system. Pulsetracer

Sea change coming for range of diseases.

How often you use an inhaler

Diabetes - levels

Technology coming.

In clinic - telepresense robots from Willow Garage.

World's best could visit you in the form of a robot - even surgeon.

Hopefully this will enable docs to spend more time with patients - higher touch.

From robots that visit to robots visiting inside body.

Do things surgeon could not do before.

3D vision inside patient.

Do things in a closed system. Overlapping technology. See blood vessels. Overlay CT scan . Tell where to go and where not.

Decision support. AR.

Remote mentoring.

The best surgeon in the word can be mentoring a surgeon in Mumbai while they work remotely in the US

Also going to scarless surgery.

Using natural orfices to insert instruments.

Pre planning on surgery and understanding that patient to decide what the optimal plan might be.

example: Patient needs a valve replacement, enter ER that already knows who they are via scan, personalized medicine and thereapy devices determine what the best operation is for that patient. Simulation operation is done and eventually the actual procedure is done and a Dr. never has to be in the room.

Robotic tech intervention in medicine can help in combat

Moving to the ability for our brains to control things, we can start to minituraize implants, put them on the brain which can actually allow patients to control wheelchairs and computer interfaces, example: LUKE Arm by Dean Kamen, using skin muscles not brain interface

Video here /talks/dean_kamen_previews_a_new_prosthetic_arm.html

Cybernics, Hybrid Assisted Limns (HAL)

Exponential growht of technologies to contain obesity: metabolism monitoring to reduce fat accumulation.

Getting smaller and smaller devices e.g. iPill, goes through gut, images, releases chemicals

Lab on a chip, micro tech is helping diagnostics in addition to therapy

Turning a cell phone into a microscope

Even further down the line: Nano-medicine - build things on a molecular level that will affect diagnosis or therapy

e.g. respirocytes, microbivores, and artery cleaners

Nano tattoos that could monitor your glucose levels

Personalized Medicine - delivering the right drug to the right person at the right time, today we are much more generic with our therapies

Using 23andMe to know risk and live accordingly

Proteome/Proteomics - the sum of all the proteins in the human body

Geo medicine - how your environment affects your health /industries/health/geomedicine/index.html

P4 - healthcare

P4 Medicine Dr. Leroy Hood

predictive

preventitive

personalized

participatory

Health 2.0 - connected, crowd sourced - what drugs are working, what are the side affects

Flu Trends

Moving to targeted molecular & genetic thereapy

- background in oncology and still today most of what we give patients is just patient

- using a micro array to genotype a patient and use the specific drug for that patient

e.g. Gleevec - blocking mutant tyrosine kinase receptors chronic myeloid ...

Personalized oncology - CollabRX

e.g. Breast cancer , if you have a particular marker Tykerb and others can target just that marker

Cancer biomarkers: CEA

Innovation is challenging - lots of hurdles along the way of research and clinical trials

Prediction - that technologies of the future will positively impact healthcare to:

Empower

Enable

Enhance

Cure the well before the get sick

The future of Health = Stage Zero Medicine

How to leverage exponential technologies to make approval process faster?

How can we use computational biology to make the process more efficient.

Exponenetial tech is enabling you and your provider, enhancing wellness and preventitive abilities

Q: How will this affect practitioners? Telepresence allows more efficiency, most doctors are getting specialties now

How will this affect the poor bottom third of the world?

Q. Will crowd sourcing of medicine lead to open science?

In addition to what Daniel mentioned (the collection of medical data from many different sources) - there are communities formed to crowd source knowledge in specific disease communities:

http://www.patientslike /als/community

there are many communities like this...

PLOS [ref]

On question of how we deal with negative genetic information-- not badly:

/sciencenow/2009/07/15-01.html (\"despite the diagnosis, you're unlikely to become more anxious or depressed within the next year...\")

PART 2 ==========================

Slides: (10 MB

/fileview?id=0ByuGXnC_X6-QZmZhZDQ0N2UtMGNjOC00OTE4LTk5MTgtMDcyNzQ5MTE5MDk2&hl=en

Embryonic stem cell - pluripotent, risk of tumor growth

Adult stem cell - multipotent, generally come from same patient

- blood forming blood cell in bone marrow is rare and can turn into all the different blood cells

- determine stem cells by oberserving function

[end of presentation]

Watch 2 minute Tech Update on YouTube:

/watch?v=EyNBZMjz2QU

on SU video server:

/#/Play/contentId=12569090359a5e04

=================================================================

Question Template [for copy/paste - do not use]

Vote by adding +XX where XX are your initials (see key: /initials)

Student Question:

Student Votes:

Student Comments:

Faculty Response:

=================================================================

Student Question: What is the commercial trend of these technologies? I.e., are they getting cheaper? How fast? How fast before they become commonplace in the developing world and get exploited to their full potential?

Student Votes: DC

Student Comments:

Faculty Response:

Student Question:

Student Votes:

Student Comments:

Faculty Response:

Instant Evaluation:

/gsp10/feedback/week-2

---------------------------------------

Thursday

7/1/2010

10:15am

MED CL2 Stem Cells & Regnerative Medicine

Daniel Kraft

Slides: /fileview?id=0ByuGXnC_X6-QZmZhZDQ0N2UtMGNjOC00OTE4LTk5MTgtMDcyNzQ5MTE5MDk2&hl=en

Audio: /leaf?id=0B0vcBiirD3NQYjNiZDYyYjYtYjdkMy00NmVkLThmMDYtZDY5NDRiN2Y3MGQw&hl=en

Second lecture - regenerative medicine.

My home camp.

Repair replace or regenerate.

Lost arm - how could you regrow that limb.

Stem cells - could become any type of cell. Root of the cell \"family tree\"

Stem cells can come from embryos, there are adult stem cells in most of our tissues, from placentas, and from bone marrow.

We're not talking about treating people *with* pluripotent stem cells - if we did, it would grow into a tumor!

We're talking about using stem cells to recreate missing tissue

/wiki/Cell_potency

/wiki/Mesenchymal_stem_cell

Blood-forming stem cells come from bone marrow. First stem cells described, about 20 years ago; really rare.

How was this measured? Have to verify that they can differentiate. One way is by using antibodies to distinguish the differentiated cells by proteins on their surface, and using flow cytometry (FACS, fluorescence activated cell sorting) to measure the antibodies.

/wiki/Flow_cytometry#Fluorescence-activated_cell_sorting

People in Hiroshima, Japan died from radation, not blast.

Firefly gene - that glows.

Stem cell can be seen moving to mouse brain.

'';'((((

About 10 years ago, NIH (National Institute of Health) put in stem cells for brain that ended up in heart. Revascularization - heart gets better.

Infarction - area of poor blood flow - can heal.

Patients with only 50% throughput improved significantly.

Example of cells being applied with a catheter (/wiki/Catheter)

100,000 people lose lower limbs due to amputation every year. [ref]

Improve blood supply and put in patches to heart.

Grow in petri dish - organ genesis in general - happens in context.

De-cellurize heart. Leave structure. Can seed with stem cells which just repopulate the matrix.

They (the stem cells) know what to do.

Future of organ transplant. Might be possible to de-cellurize pig hearts, or print the matrix.

News last year about first artificial trachea. Seeded with endothelian stem cells - grew \"own\" new trachea. Successfully replaced the trachea

Artificial organs - bladder. Grown in bioractor.

3D printing of cells. Many groups working on this. Layer cells and tissues to create organ.

Organovo [ref]

Bio-ink

Print out what would be future vasculature - most important thing is blood flow.

Ideally those cells come from the same patient.

In the works today:

Parkinsons. Bone marrow cells made to become neural repair cells.

Spinal cord injury - addressed with neural stem cells

e.g. NurOwn

Alzheimers - may be halted or reveresed.

Where do stem cells come from?

Bone marrow. Must be done about 200 times. Requires about 1 liter of cells.

Injection approach.

Cord blood stem cells - if you are just born. Parents want to bank away.

If child or mother has leukemia.

This is what half a liter of bone marrow looks like.

Spent a lot of time doing 200 hole puncture draws.

Patient's rear end looked like swiss cheese at the end.

Maybe better, faster, cheaper way.

Came up with marrow miner - drill through cavity. Can suck out rich supply through one spot.

Possible to create bone marrow environment.

Grow red and white cells without having to be a donor.

Cancer Stem Cells.

Most patients relapse. They've been inremission. But it comes back.

Reason may be: cancer stem cells.

Big guns of chemo,radiation leave roots behind.

These cells look different under the microscope.

Take 10 of these cells and you can grow a human breast cancer in a mouse.

These stem cells are the RIGHT target. Metastatic disease is what kills the patient - so this is what you want to stop.

/wiki/Metastasis

/wiki/Metastasis

Spinal cord leison. Could result from diving into a swimming pool. Could be fixed with these cells.

Science problems to overcome.

Political / ethical

How to differentiate cells

How to build organs

How could you make your OWN line - theraputic cloning

very expensive process. Take out nucleus from egg from donor. [video]

put in nucleus from new donor. Wait 14 days and off you go.

On the cusp of making \"induced pluripotent stem cell line\"

Each cell has same DNA.

Just a matter of re-turning on the program.

That is exactly what is starting to take place.

Yamanka [ref]

Viruses used to create IPS cell. This could then generate whatever you needed.

Core blood banking now. Put in cheek swab - let it be used for you later downstream.

Problem is viruses could cause tumors themselves ...

Another group using cocktail of chemicals, not viruses.

What drugs might help disease - as marked by particular cells.

=================================================================

Question Template [for copy/paste - do not use]

Vote by adding +XX where XX are your initials (see key: /initials)

Student Question:

Student Votes:

Student Comments:

Faculty Response:

=================================================================

Student Question:How long is it before we can combine 3d printing, cell printing, tissue culture and stem therapy In vivo rather than in an external bioreactor

and further into the future, could we imagine that this will one day be automated and unobtrusive to normal living function?

Student Votes:

Student Comments:

Faculty Response:

Student Question:

Student Votes:

Student Comments:

Faculty Response:

Instant Evaluation:

/gsp10/feedback/week-2

"

/core-Jul14-BB

"7/14/2010

Wednesday

9:00 - 10:00 am

BB CL5 Biotech that Matters: What's actionable?

Thomas Goetz

Slides: /present/view?id=0AWIj9HPeinaFZGY2cDNjOXpfNTMyZ2N4Y2tkZHE&hl=enz

10:15 \u2013 11:15 am

BB CL6 Biotechnology's Darker Side

Rob Carlson

Slides:

11:30 \u2013 12:30 pm

BB CL7 Life in the extreme: From undersea vents to asteroids and beyond

John Cumbers

Slides: /fileview?id=0B2Ij9HPeinaFZTEzMzUyNzYtOTA5ZS00MzM0LTgwYjMtYTViNWFjNzUzNDll&hl=en

Raycho's birthday today. [cheers]

Andres Hessel: First four lectures giving you orientation to biology.

Linda Avey: Social layer

Business going exponential - data driven methods

Thomas Goetz, Exec Editor of Wired.

\"living by number\"

Book: The Decision Tree [ref]

/Decision-Tree-Control-Personalized-Medicine/dp/1605297291/ref=sr_1_1?ie=UTF8&s=books&qid=1279124028&sr=8-1

TG: Hope this is going to be fun.

Themes in the book.

More broadly, confluence between technology and health / health care.

Masters in Public Health.

Normally, antagonism from PH world toward tech.

Start with early example of biotech.

Aspirin.

Invented by Bayer.

acetylsalicylic acid - a miracle

First true drug that pioneered pharma industry

Caused some stomach pains, even gastric bleeding.

Known side effect.

/wiki/Asphirin

So significant, FDA would have stopped it.

Another effect. Seemed to help with heart disease.

People who take it every other day have lower risk.

Took 100 years to find this out.

Negative effects found quickly.

Positive effect not found until 1988. Confirmation.

One thing, looking historically - drug's beneficial effect - men who take it have 44% lower risk - people were having this preventive effect, but that pattern,

the A and B correlation,

was lost.

That pattern recognition is the result of big data.

Aspirin story belongs to Brin.

Photo from mid-90's when he was in grad school.

Finding patterns.

Market basket analysis.

Start with cash registers. Very widely available.

Highly incentivized.

Buy diapers and beer together? If you buy diapers, get coupon for beer.

Glean for insights. Get higher sales, improve profits.

Brin, at Stanford, wanted to mine all kinds of other datasets.

Student records, enrollment.

Web searches - which informed Google.

Market basket of medical records.

Great dataset related to aspirin - being captured, but lost.

My involvement was through travel.

Opposite of Google. So little appetite for innovation, they just wanted the big engines of industry to work.

SABRE - selling tickets.

/wiki/Sabre_(computer_system)

In late 90's, problem was they lacked real ability to process it.

Not just travel, but whole approach to data

CRM -

/wiki/Customer_relationship_management

Data was there, but impossible, given state of computer systems.

- Everything we do is DATA.

Every function of daily life generates data.

Interested in the way that effects our health.

Decisions, operations - how to capture and analyze.

Like one big experient.

All these inputs and outputs.

If we can assemble the patterns, connections between A and B of our daily lives, we could learn from them.

Data mining for health is so important.

Opportunity now:

- computing power

- storage space

- sensors

Three trajectories.

Getting cheaper and cheaper.

Will review effects of these three.

- SCALE

- Exponential increase in computing power

- US Air Force Office of Scientific Reseach, 1953

Put together modes of transportation

/thetechnium/archives/2009/07/was_moores_law.php

- Moore's Law [original chart in \"obscure trade magazine\"]

- photo, 1954, \"Home computer of 2004\"

Computer will require not yet invented technology, but 50 years from now scientific progress is expected to solve these problems.

A lot is similar. The keyboard and monitor. The difference -- no steering wheel.

- 2004, state of the art, iMac

This is the pace of change transforming how we process and transform data.

- iPod, from 5GB/$500 to latest

Seen them get smaller and smaller and bigger and bigger

Starting Google - filled trunk and backseat with hard drives - wasn't a TB or data.

Now, same is $100 and you can hold it in your hand.

As things get faster, faster, better, better - you can move from cash registers, to web services, to medical records, to everything we are doing - as storage and sensors get cheaper.

- 5 m people in US have used Nike+

Oval thing is accelerometer - cheap.

Mandated for use in airbags in cars.

Measures motion in 3 dimensions.

All auto use gave huge incentive to make them cheaper and cheaper.

Then, so cheap, Nike and Apple got together and realized they could put these in shoes to track motion.

Now able to track calories, cadence, speeds, upload to website.

Number of runs per week,

calories per day,

set goals.

Haven't shown us what we can learn from that amount of data.

You can build on your OWN data, but not the overall dataset.

- zeo

Sleep tracking.

Simple sensor.

Classic type of sleep analysis. Go into sleep lab, but already messed up experiment. Not your own bed.

Sensors are cheap enough, measure brain waves.

Close to lab based experiment, but everyday in your own home.

Find patterns -

drinking too much, miss sleep

exercise more, sleep better

Zeo allows you to export data to other services, get re-use of data

Sleep is emerging category of health. Now finding associations with our health.

Power of combining

Lab of Quant Med, Harvard

- /

Has combined simple bio-stats. Sex, age, weight, etc.

Gives specific suggestions:

take aspirin? How many days of life would this add.

When given blanket recommendations, may or may not be swayed.

In this country we are inclined NOT to do the things we are supposed to do to be healthy.

Getting people to change their behaviors is a huge driver of our health care problems.

When they can see how their behaviors have consequences, when they can see the trajectories of their lives, then behavior changes.

- Data means more when it's our data

Example

Pregnancy Symptom Tracker

- Morning Sickness

Compare your status with other women

About a third of women have morning sickness at the peak

- Mood swings

- Faiting - at the end it jumps to 35% in last couple weeks.

If you start fainting a lot, it means you are about to give birth.

\"I wonder if this is something that others have ...\"

- patientslikeme

75,000 individuals

ALS

Contributing granual data

symptom severity

drug dosages

how effective

all that data becomes grist for powerful insights.

400 patients who read a piece of research in Italian study of 12 people taking lithium.

So, with this hint, over 400 patients started to take lithium.

outpaced published research on remarkable scale.

Found, crunching the data together,

early - 6 mos in. Now 2 years in.

No effect in slowing.

But an insight. Crowdsourced verification of published data.

Brin.

Interested because he has genetic risk of Parkinson's

Thomas's Wired story [/magazine/2010/06/ff_sergeys_search/all/1]

23andMe

Talking with Ann and Linda ...

Parkinson's Disease Genetics Initiative [ref]

Ask all kinds of questions. What possible associations might pop out?

Profound different way of thinking about science.

- illustration from Wired [/magazine/wp-content/images/18-07/ff_sergeys_searcH5b_f.jpg]

Association between gene and Parkinson's.

Researcher had hypothesis in 2004. Drove a dozen studies, with 5000 patients. Pooled that in meta-study with 64 authors.

Took 6 years.

Traditional pace of academic research.

Then came 23andMe. About 5000 patients.

Roughly the same.

Had in 5 minutes, same precisely identical association as multimillion NIH 6 year study.

Altogether, 9 months to gather data.

- Back to aspirin

Things happening, we aren't asking questions.

Stuff exists. Patterns are out there. We just don't know it.

Combine data with health records, DNA.

New behaviors.

New interventions.

Better lives for all of us.

E-mail: thomas@

9:48 [applause]

Andrew: Use mic for questions.

Emem: from Nigeria. Wonderful presentation. Medicine still comes from the West. Human life started from Africa. Do we have ways to mine data from Africa? If not, collaborate? Very important, help with overlooked problems.

one of the problems with drawing relationships - most research done on European, white populations. If you come from a different race or background, associations might not hold.

Broadening of pool is starting to happen. Sequencing costs, from Carlson, are getting so cheap that it is much easier to test more people.

Not aware of specific project, but big at NIH.

Bryce: Fantastic presentation. I study policy in PH and systems. Specifically privacy. NHS (UK health service) - doing what you are talking about. Here, HIPA - difficult to have mass scale data gathering. Barriers? Increasing problems?

Interesting on privacy. They get a lot of attention. Megaphone is very large.

But, three populations in the US

10% privacy fundamentalists

10-15% people who don't care- nothing to hide. Not on the radar for them.

70% in middle are privacy pragmatists.

Depends on circumstances

Trade offs and benefits.

opportunity for benefits is increasing.

Join genetic study? Don't get data back. Kaiser doing huge project. Lots of general health data. But people in that study don't get data back.

Contrast Boston project

23andMe

Abiltity - upside - health and DNA information is \"currency\" can donate to patientslikeme and get things back.

Contrast NIH research with grassroots, entrepreneurial opt-in research.

Agree to join because they understand the exchange that is going on.

Heartening trend.

Always in the best cases, with great diligence toward protecting information and knowing what is happening.

: Quantified self. How they live lives? Due to data? or culture of people who have grown up with dataset?

Quantified Self founded by guys in the Wired family [Gary Wolf and Kevin Kelly]

/

10:10 [applause]

Slides: /present/view?id=0AWIj9HPeinaFZGY2cDNjOXpfNTMyZ2N4Y2tkZHE&hl=en

10:21 AH: Rob Carlson

Considered the Gordon Moore of synthetic biology.

Known Rob for about 6 years.

I'm an optimist.

Rob is here today to give a pragmatic look at

risks

and opportunities.

Rob:

Original title was supposed to be \"Dark Side\"

but I have trouble with that.

More like \"Flip Side\"

Biodesic is my excuse to do this stuff for myself, rather than other people.

Everything I am going to say is in the book,

came out in Feb

my blog [ref]

Synth is a set of tools. Not end-all, be-all.

Does facilitate our abilities to make new organisms,pathways.

Here is the past - photosynthetic sea slug.

Multicellular organism - harvests chloroplasts.

Can subsist on sunlight for some number of days.

Harvard building photosynthetic fish.

Figuring out what they can inject -

Will have functional within 5 years.

Now cars.

Favorite.

Legos coming together.

Model of how they go together.

Honda Element.

All built that way.

Technology allows fabricating things this way.

Use of technology - mis-use - becomes important.

- Hierarchy

Single gene in a single cell.

Coming soon, multiple genes in single cell - for plastics

Malaria drugs - fuel from sugar.

Early next year.

Multiple cell types - Claudia Castilla - /group/biotech/forum/topics/esophageal-transplant-using

- Parsing the Spread

Biology does it better than other human technologies

Will move into production over next 5-10 years.

Beer instead of oil

Uncertainties ... price of oil ... what US govt does about electrification.

- GM stuff

GM Crops ~80bn

Biologics ~70bn

Industrial ~100bn dollars

Growing about 15% per year.

Currently at same level as mining in US.

- Scale and Regulation

More fuels / materials at an increasing pace in industrials.

With $10-100,000 you could have new protein with value in the marketplace.

- US Market Value of GM Crops

- Average US Corn Yields - No End in Sight

More biomass, despite decline in planted area.

China has 80 bushels/acre. US at 160. Top crop 300.

- Global adoption

China 2.5% - target 10 years out - 8%

India 1.5%

Pakistan - all pirated GM copies 1.4%

- Arable Land

Who has resources?

US has largest fraction.

Australia has largest land per capita

China / India at the bottom

- China and Biotech

Fermentation

About 40% of corn used for industrial production

- One Page Molecular Biology Primer

DNA, mRNA, etc.

- Oligo Synthesisand Gene Assembly

Patch short pieces into longer strands

- DATA

- Enabling Tech are Improving Rapidly

Moore's law

Commercially available DNA sequencers, synthesis

- Cost of writing and reading DNA.

Still pretty expensive.

Lot more economic impact from these things.

- Synth Bio

Cost of genes, the raw materials.

What is interesting, these lines come together

Difference is max profit margin - going away exponentially.

Limited lifetime.

Desktop gene printers before too long.

- Longest DNA made

About a megabase now.

/2010/05/booting-up-a-synthetic-genome-1.html

- Liquid Fuels Have a Long Future

Gasoline is better than everything else on power density / energy density chart.

- punch line: pressure to come up with alternatives.

Not clear there is a lot more oil to come ....

Clearly a different regime.

Steady from Jan 92 - 99

Different now.

- Biofuels: Food v Fuel

Dramatically oversimplified.

No one is turning vegetable oil into fuel.

- Biofuels: Diversity

If we need biofuels, we need a LOT more innovation.

- New Tech to Address Threats. SARS.

by time we figured it out, it was over

We are inept.

Takes a year from pathogen to vaccine.

SARS was over in 6 months.

If different, we would have needed a vaccine that wasn't there.

- The answer

SBIR - garages - everything we rely on in modern life today.

- Micro-brew

Chart of craft breweries - grew up in industry dominated by large industry.

5% of beer by volume, 9% of revenues. [Brad?]

- Biomass

AGATE - food waste, green waste - replace 80% of fossil use, could go past 100% if we worked at it.

This is the future. It does not have to be large.

- Just what is a \"Biofactory\"

Small stuff.

- Costs of scaling up

Shell - $1 bn on doubling refinery.

Biology - double number of cows.

Won't cost as much to increase bio production.

- Combines.

Big Dog.

Mobile bioprotection facility.

Machine that eats leaves, forages to supply power.

DARPA building something that lives off the land.

- Mobile, Autonomous Biofactor.

Fusion of biotech

- Tech Dev is Distributed

Many individuals

Lilienthal 1891

Langley 1903

Chanute 1890s

- Synth bio

4 companies delivery 9% of DNA in the world

- iGEM [ref]

Design framework. Almost nothing works every year, but students are creative. Rephrase that: stuff works, just not the way expected.

Students scare me with the stuff they come up with: 25 genetic components.

- Sorona

Improved carbon production, higher yield per material input

- Synthetic Cells

Venter.

Bug he made had 1000 genes in it.

10s of person years -

no ideas how to use 1000 genes.

Maybe 50 genes max. More likely use 15.

- Caveats

Diffusion is not always very fast.

Cell phones went faster - underlying technologies.

- Biology: WIRED cover. May 2005.

Think of threat, opportunity -- or REQUIREMENT

- My Garage lab.

- Distributed innovation

3D printing

RepRap [ref]

Fab Lab [ref]

Fab@Home [ref]

- LavaAmp PCR [ref]

USB powered. Not wall wart.

/wiki/AC_adapter

- Shock of the Old [ref]

David Edgerton

- Unexpected Impacts of Prosription

Cocaine - Narco-subs

Meth

Use continues to rise. Now made in Mexico.

Created bigger blacker market - made it worse be enforcement

Markets worth billions of dollars for DNA. Clamp down? Profits will find a way.

- Akihabara [ref]

Maximize knowledge, Skills, Awareness [eduction?]

- Reading

Biology is Technology

/Biology-Technology-Promise-Business-Engineering/dp/0674035445

The Big Squeeze

/product/paperback/the-big-squeeze-new-fundamentals-for-food-and-fuel-markets/2969414

Genome Synthesis and Design Futures

/2007/02/21/genome_synthesis_and_design_futures_implications_for_the_us_economy

10:59 [applause]

Q: Competition between nations.

Yes.

Q: 1000 genes

Venter - can write and compile 1000 lines of code

Copied them from nature

Problem is, don't know how to put 1000 genes together.

Q: LIC - bovine genome?

Won't help.

Correlation with traits.

Versus what goes on in a single cell.

going to take a lot of hard work - measuring.

Error bars on most biological experiments big.

Q: Alberta, Canada. Carbon? open source?

Objects that function.

World be safe.

Patents are crazy, expensive.

Capital cost, not including labor, but cost is 10x that - all lawyers.

Only thing I can do right now to defend invention.

Can't copyright DNA.

Need something to secure - or no one will invent.

Open source is a hack on copyright.

Brilliant.

Can't do the same for DNA. Wish we could.

Seems like sharing is better. But you still need $1 bn for a drug.

I'm confused still about what the future should be.

No ability to do anything with DNA other than public domain or patent.

Case against breast cancer claims - first time judge ruled on patentability of naturally occurring genes.

Erez: GM trends?

90% of corn/soy is GM

Sugar beets went to 95%

In US, not any barrier.

No physiological harm. Many \"stories\" say, but no empirical data.

Great benefits, don't appear to be any harms, like gene transfer, effects on pests.

GM label - if farm animal eats GM, meat needs label as GM.

- Unexpected Impacts

Might have to slaughter early, since non-GM feed was not available sufficiently.

Problem will come back. People will decide GM crops are OK.

China coming.

India/Pakistan coming.

I don't feel strongly, but I base my decisions on data.

We have 10 year history.

: Modified cotton.

Isolated case - piracy -

In 2005/6, Brazil was given official numbers, genetic soy +60% , taking over.

Approved in 2005. Just reported what they had been planting for years.

Most 1998 - farmers had taken GM cotton and crossed into variety with some disease resistance. Weren't following instructions.

Monsanto's products approved for 2012.

Suspect, given 30% economic benefit - due to pesticide use, not yield.

When we do engineer for yield, they will take over.

Hassel: Impression - we are going to have to build this.

Field of syn bio was just birthed a few weeks ago.

Will go exponential very quickly. It is greenfield.

Economic.

Regulation.

Fantastic blog at

Book, wonderfully referenced.

Thank you Rob.

11:18 [applause]

11:30 \u2013 12:30 pm

BB CL7 Life in the extreme: From undersea vents to asteroids and beyond

John Cumbers

Slides: /fileview?id=0B2Ij9HPeinaFZTEzMzUyNzYtOTA5ZS00MzM0LTgwYjMtYTViNWFjNzUzNDll&hl=en

- Life in the Extreme: From Undersea Vents to Asteroids and Beyond

John Cumbers, John.Cumbers@nasa.gov, PhD. Candidate

Brown University, Molecular Biology, Cell Biology, Biochemistry

@NASA Ames Research Center, Moffett Field, CA.

- [Hubble deep space image \"big bang\"?]

- Astronomer's Periodic Table

MOSTLY Hydrogen

- CHNOPS - used in life

- Ten most common elements in our galaxy by mass, estimated spectroscopically

- time line of life

Most interesting stuff recently, but started long ago

Whole long period of evolution bubbling away -

- What is the origin of life?

Have we created synthetic life? [1/3 yes, 1/3 no, 1/3 not clear]

Venter's result.

- Early Earth: an organic chemistry lab

RNA & DNA - few building blocks, chain to form larger molecules

Amino acids - build things

Lipids - form cell membranes

Carbohydrates - energy carriers

Really cool thing in last 10 years, all found on meteorites we have searched in /wiki/Antarctica#Meteorites

- Nicole Rager

Building blocks of life came from intrestellar space

- Self replication is the key to origin of life

Venter hasn't done this yet [really?]

- \u201cThis is the very end of the line, where chemistry starts turning into biology\u201d

Science 2009, Self-Sustained Replication of an RNA Enzyme Tracey A. Lincoln and Gerald F. Joyce

RNA came first hypothesis. DNA can't really act as an enzyme. RNA can break bonds. Protiens are much more complicated.

RNA world was looking for self-replicating evidence.

One of the RNA enzymes they created was able to synth second, which could synth first

Which led to exponential self-replication.

Just need to keep feeding in nucleotides.

- What do we contain it in?

Inside lipid

Put self replication in vesicle

/wiki/Vesicle_(biology).

- David Deamer, UC Santa Cruz

Formed by drying ...

- Extremes of Life

100 degrees - boiling at Yellowstone

pH 2 - like car battery acid

/wiki/Geothermal_areas_of_Yellowstone

- Is the Universe teeming with life?

Planets

Organic Molecules

Water

Energy

- Nicole Rager

Meteorite impacts - when examined on Earth, some came from Mars

/wiki/Martian_meteorite

Back and forth. Cells that can survive inside rocks ...

History of liquid water on Mars, river deltas.

Mars much warmer,

/wiki/Panspermia

- Is there a habitable zone?

- Is there life already on Mars?

May be just beneath surface.

In crevices where water was flowing.

- LIFE on the moon.

Much more unlikely due to the 28 day lunar month, 14days of total darkness

Night -170 degrees C. Very hot days.

- Synth bio:

Can we design organisms and ecosystems able to sustain us as we venture off-planet?

- Venter

- \u201cIf the methods described here can be generalized, design, synthesis, assembly, and transplantation of synthetic chromosomes will no longer be a barrier to the progress of synthetic biology. We expect that the cost of DNA synthesis will follow what has happened with DNA sequencing and continue to exponentially decrease. Lower synthesis costs combined with automation will enable broad applications for synthetic genomics\u201d

Gibson et. al May 2010, Science

I agree with that

- Problem with space is launch

John von Neuman photo - self replication - send small robots to Moon, Mars

/wiki/John_von_Neuman

- Prince Henry the Navigator of Portugal: Leave sheep behind on island

(Translation from Antonio Cordeyro, Historia Insulana das Ilhas a Portugal Sugeytas no Oceano Occidental (Lisbon: Lisboa Occidental, 1717; reprint, Angra: Secretaria Regional da Educacao e Cultura, 1981 / The Azores Islands by Robert L. Santos).

\"sail towards the setting sun\"

colonized in 1433-1436 on Santa Maria and San Miguel

- ISRU - in-situ resource utilization

Better is \"don't take it, make it\"

- Why biology is the right tool for the job:

*Low mass

*Self replicating

*Fast growing

*Adaptable

*Flexible host

*A manufacturing technology

- Cells make protiens

- A cell can double in 20 minutes

- so a single cell, E. Coli, can become a billion cells in 24 hours

/wiki/E._coli

- Extremophile

chassis ->

- Understand extremophiles on Earth

to yield

Engineer extremophiles for space

- 23andMe for microbes

Dessication tolerance

...

Harmful radiation

Grow in fridge

On chart - red IT DIED, green IT SURVIVED

What we are really interested in is the one from South Africa and this one from Galapagos.

Like 23andMe. Main gist.

Building protein toolkit.

Engineer other microbes to live in extreme environment [aren't these the traits the LIC guys are trying to sort out for dairy cows? http://www.lic.co.nz/lic_Home.cfm]

- Hybrid system

Cached consumables

- incredible picture of spider web silk

Magnus Larsson, a student at theArchitectural Association in London, has proposed a 6,000km-long wall of artificially solidified sandstone architecture that would span the Sahara Desert, east to west, offering a combination of refugee housing and a \"green wall\" against the future spread of the desert.

/2009/04/sandstone.html

GenoCAD\u2122 is an experimental tool allowing you to build and verify complex genetic constructs derived from a library of standard genetic parts.

Imagine parts that allow living in cold conditions. Can I make another bacteria radiation resistant? Build up parts.

[video showing how to]

Just give me this promotor region.

Building up step-by-step.

You could also automate this. Create 1000 different genomes and try them out.

Don't see any DNA.

Will press Print at the end.

output: attgtgagcggataacaatagg ....

Send that to a synth device.

- Quote from Editorial in Nature Biotechnology Dec 2009.

- Tom Knight, MIT : \u201cThe engineering of biology remains complex because we have never made it simple\u201d

12:17 [applause]

Hassel: How easy, only getting easier.

Doing 23andMe on current organisms. Any program to apply selective pressures? Morph them?

Instead of rational design, just use evolution. Keep exposing to higher levels of radiation. John Batista - rad resist e.coli

http://www.biology.lsu.edu/faculty_listings/fac_pages/jbattista.html

More interested in rational design, but evolution may win.

Q: David R/US: Extremophiles - protect or repair?

Some produce pigments that absorb. DNA also abosrbs. Radiation hits pigment.

Other novel repair - double checks.

Deinococcus radiodurans check if genome is OK.

Q: One or other, not both?

Biology continues to surprise me. No logic to how natural selection does it.

Lot of transfer of genetic material between bacteria.

12:23 [applause]

From today on, 583C

Rock star VIP speakers

Bob Metcalf 1:30

Jack Hidary 5:30 - 6:30

Dean Kamen 7:30 - 9:00

Jose: All about Energy.

12:28

=============== POST-presentation notes

Instant Evaluation:

/gsp10/feedback/week-4

/viewform?formkey=dGZadGpDejljY0JaWnRnV2Q1SEdYRGc6MQ

Ignite specifications:

/present/view?id=0AcWBCQSXI2ESZGNjbXN3M3RfMTNjcmpkNzhjbQ&hl=en

=============== NEXT PADS

1:30 Bob Metcalf - Enernet

/event-Jul14-Enernet

/tpenergy-Jul14-Team-Meeting

/tpfood-Jul14-Team-Meeting

/tpspace-Jul14-Team-Meeting

/tpupcycle-Jul14-Team-Meeting

/tpwater-Jul14-Team-Meeting

/event-Jul14-Liddy-Karter

/event-Jul14-Jack-Hidary

/event-Jul14-Dean-Kamen

"

/core-Jul9-NT

"7/9/2010

Friday

9am - 11:15am

NT CL5 MEMS (George Skidmore)

Slides:/fileview?id=0B6vjqTaW5opaYzNkOWNkMWYtZmI5MS00YTQwLThiZDAtOTUzOWM1NmVmNDE3&hl=es

http://bit.ly/c46VxV

NT CL6 Positional Assembly (Ralph Merkle)

Slides: /fileview?id=0B6vjqTaW5opaNGQwZmI5NzUtYmQxOS00ZTgzLWE2YzQtYmJhYjAwM2ZjYTA4&hl=es

NCS CL6 Social Networks and Networked People (Kevin Marks)

Slides:

/c2hwhoqdmlfj/social-web-standards/

/jdqehbzqxlyr/social-web-tummeling/

=============== PRE-presentation notes

Erez has introduced a new SUMMARY Etherpad:

/Pad-One-Liner

Please contribute.

Slide marker in Etherpad:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

[ref]

If you need a reference, use this marker.

PRIOR NT pads:

/core-Jul2-NT

/core-Jul2-NT-discussion

PRIOR NCS pads:

/core-Jun29-NCS-CL1

/core-Jun29-NCS-CL1-it

/core-Jun30-NCS

/core-Jun29-NCS-CL2

/core-Jun29-NCS-CL3

=============== End of PRE-presentation notes

We should ask George Skidmore about IR chip fabrication cost.

9:20 Merkle: We will soon be starting our morning session.

MEMS.

The ability to use micro machines to make machinery at the small scale.

To introduce us to this area we have George Skidmore.

Zyvex? [ref]

/index.html

There for 7-1/2 years.

Now at DRS [ref]

Making actually machinery at MEMS scale.

Showing fascinating videos.

Showing what MEMS is doing today.

9:20 George: I'm over here running an infrared camera.

What it is doing is imaging the thermal radiation.

It can see coffee and cold drinks.

We build a lot of sensors.

Company I work for now is a world leader in these kind of cameras.

Come back to the main podium to get started.

Micromachines. Built at - couple of microns. Not quite nano machines of next talk.

Getting below micron now.

- Introduction to MEMS, NEMS and top-down nanotechnology

- Outline

A few product examples.

Been around for along time.

Operational principles

End talk on project

- MEMS/NEMS \"defined\"

Mechanical or electromechanical devices made with IC fab technology

Here showing gear train.

Sandia famous for these mechanisms.

Mechanical material is Poly silicon - sometimes single crystal silicon.

These are training wheels for nanotech, or a way to approach nanotech from the top down

There are other names for MEMS that will get thrown around

Microsystems Technology...Silicon Micromachines...but it's the same tech.

50 nm on guitar strings. Don't think it plays. Just sits there as a stunt.

- Length Scale

Dividing line

With wavelength of radiation - half micron - that your eyes are sensitive to.

Below that, nano.

Molecular is below NEMS.

Characteristic lengthscales:

MEMS: 10micron. NEMS: 100nm. Molecular Machines: 1nm.

-MEMS Products

Field has been around for about 40 yrs. First devices were pressure sensors, used in autos.

Inket printhead is MEMS.

Optical MEMS - MOEMS is a whole field. DLP is a prime example of that. Arrays of small - 15, 17, 20 micron - mirrors, physically moving back and forth and reflecting light.

IR camera would also fall into that class. But that's wavelengths greater than visible.

RF MEMS - resonators, switches, cellphone apps

Airbag sensor - accelerometer. If it weren't for federal regs mandating this, MEMS wouldn't be the field it is. Most of you have several accelerometers on you right now. Wii, iPhone, Android etc. Accelerometers are MEMS.

Microphones

Relatively recent

- Operational principles

- Gravity is basically irrelevant, but surface force becomes big.

- Electrostatics becomes big.

- Another thing that's really different is heating and cooling - they happen really fast. About 10ms time constant.

- Actuation - electrostatic

- Actuation. One popular principle is electrostatic - charge up two sides and pull them together. How DLP works. Picture shown is a comb drive. These are low power, 'fast' (in the mechanical sense) 50kHz. Disadvantages are weak forces.

- Example electrostatic actuated devices

DLP is an electrostatic device. It's an array of flat-plate mirrors. They have a via in the middle, but they're a piece of highly reflective aluminum. I brought a DLP chip to pass around. You won't be able to see the mirrors, though. There are three of these in the projectors that display digital movies. 2k by 1k cinema chip.

Now pico versions 640 x 480

- Actuation - electrothermal

Sending current through this device.

Chevron beams. Heat material up to get some motion from thermal expansion.

Thermal expansion is pretty small - ppm - so we have to use some amplification.

Slow in a mechanical sense - 1kHz.

- Fabrication Processes

In principle, as simple as any IC fab - about $1 bn. [ha ha]

Start with silicon wafer. Deposit. Etch. Repeat. Build up layer.

In the end, cut away stuff we don't want.

Even more complicated than $100 m. Thicker layers.

Stress control is very important.

Unlike IC.

If you don't pay careful attention. Aspect ratios - 1000 times wider than thick.

- Simple fab - step 1

6 inch wafer.

ICs use 12 inch.

- 2

Deposit insulator - don't use wafer properties except that it is flat.

Great mechanical, just platform

- 3

Build layers

- 4

photo resist. Can spend as much as you want to get pattern on there

- 5

Transfer - reactive ion etches.

- 6

Strip off - either wet or dry

- 7

Deposit polycrystalline

- 8

Pattern with lith process

- 9

Strip away.

- complete

Generally more complicated. 10 different layers. DLP will have 10-12 layers.

- Electrothermal actuator

One layer of Gold on top, make contact with it.

Thin film interference color.

Then e t actuator couple hundred microns wide, 2-3 microns thick.

- Other tech

Silicon will etch - AFM was early MEMS device

Etch facets to give peak. Almost atomically sharp, but not quite. 3 nm radius.

- DRIE

Deep reative Ion Etch

Straight through 10s or 100s of microns. Straight sidewall.

High aspect ratios.

Used in some accelerometers.

- surface micromachining

Probably most popular one

-off the shelf

If you want to explore on your own.

Multi-user MEMS

Equivalent of moses. MOSIS: a US DOD program to fund student fabrication of chips

A national initiative to aid smart kids to build real devices, yielded thousands of chip designers at the moment that new CAD software let anyone become a chip designer.

you can buy yourself 1 cm by 1 cm of MEMS

You'll get 15-20 copies

for $5-10K

Could not recommend more strongly.

Don't try to get own process, buy own fab

Great way to learn - university

But if you want somethign to work, use this.

/en_mumps.html

- Microbolometers

Do we have a camera functioning. Pointed at me - great.

For this device, had to claim we built this 50 micron.

We are a bit behind what you can buy in CMOS megapixels.

We built wafer. Suspended with low conducing lace?

If I heat myself up, change the temperature, this little microbolometer absorbs that radiation

50 mK 0.5 degrees Cent. sensitivity.

Transducer vanadim oxide, changes resistance, interrogate and report.

Thermometers in an array 640 x 480 readout.

E6010 uncooled 640x480 resolution, 25\u00b5m pixel pitch LWIR camera (~$10k)

/Products/RSTA/E6010.aspx

Plastic/glass not transmissive in the IR. So we don't use them in these optics.

- DRS

Need to package in a vacuum package.

Vacuum stainless package. Will hold vacuum for a decade or more

before they leak their vacuum out.

Glass window - germanium. Transmits IR.

Then take that detector and connect to a bunch of electronics to do correction.

Put another germanium on the front and you've got a working IR camera.

- Top down nano

How do we make these machines do things

Thermal camera doesn't move.

So what can we make move?

Project to address issues -

Parallel, exponential, or convergent

- MEMS Assembly - Core technology

2001-2006:

Gripper mechanisms

Actuators

- Mircoconnectors

/

Places on parts to grab.

All the things necessary to put something together with microassembly

Microgripper tool

- Microassembler

5 degree of freedom device

- MEMulator

[video]

In line with physical systems, also developed software.

Design them, program robot to pick and place parts.

This is a model tool. Sold off. Part of tool suite. Called SEMulator.

What you would see under scanning electron microscope.

At least one tool out there to explore MEMS assembly entirely in software.

-/coventorware.html

In real world, this is the assembler.

10micron

50 nm precision stage to do this

So we were able to do this in a completely automated way.

From this length scale, you get full robotic effect.

-

[vide]

Same sequence from camera up close

Liked high prcision parts.

Robot sytem to build.

Able to demonstrate microscale assembly and explore one of the ideas,

parallel assembly

-

[video]

More than one part at a time

Able to get pretty far in the real world.

never did demonstrate exponential assembly.

If we want to talk about actual assembly - need to talk about large numbers of parts. Many many at once.

Joking around one day. Eric Parker said we need to do parallel. let's do exponential. Try it. Started designing all these MEMS things. Rotational stages, put all those tings together.

Wafers. Two together. Step across. Have those 2 build 4, then 8.

Orthogonal XYZ then put rotaitonal onto MEMS parts tehemselves.

One with gripper. Build mirror cpies. Put first together somehow.

Then full exponential ...

Only in software to date. But this is the concept.

This looks like gripper. Rotational stage. Electrical traces.

Make a couple of stages, then put that robot to work.

Then you only need those degrees of freedom for the exponential to occur.

Concept is still sound. One of these days someone will be able to pick this up again.

9:53

- Summary of MEMS

Around for 30-40 years.

in consumer products.

Steal all we can from IC

Electromech, etc added.

Been considered, still is, worthwhile approach. Work our way down to nano.

9:54 [applause]

Merkle: Excellent talk.

: Major hurdle?

G: Connectors. Robotic pick and place. Full rotational stage. Did get assembly done. Never did get second one. Ran out of time and money.

Some of these snapconnector mech are not robust enough.

Probably need bracing

Merkle: What is the product that would have generated revenue stream to support research?

G: Good answer too. Tech barriers, but putting one of these togehter - any MEMS product - no body knows the right product.

MEMS is a miltary product. It can be expensive. We can have a dedicated fab for it.

Derek: Neat talk. MEMS in small approachable scales. Assembly robots, some pretty high cost. 50-100 quantity. What about assembly?

G: Another cost barrier. ir camera. Taking MEMS and wirebonding it up to interact in the real world. Generally silicon cost is less than packaging cost.

Generally prohibitive. each is unique.

University lab environment you can play with probes.

In real world, you will spend

We spent 50-75K on assembly. Today maybe 25K.

Sasha/Canada: If not constrained by IC process.Is there a differet, ideal way to approach mfg?

G: [very thoughtful] Don't know an answer to that. I'm a little too stuck in the real world of how you get things built. How to do what we can. Never thought through the ideal way. See Merkle. Sorry.

Ala/Abu Dhabi: What makes ... silicon appropriate? How powered?

G: Silicon is mechanically extremely good. Exceptional for this kind of device or small MEMS. Metal at small scale is ductile, maleable. Silicon is like a rock. A piece of glass. Covalently bonded. Always, after you've bent it, comes back to shape. Until you break it. Perfect elasticity.

Glass, silicon, other ceramics.

Si and Si oxide. Ralph likes diamond.

Second. Power. In every case, we run a wire to it. Big fat gold bond wire 100microns at least. Very few energy harvesting mechanisms at this scale.

Packaging issue. How do you get power to it. Big constraint.

Emiliano:

G: Question is, RF applications? Look up sitime /

They build resonators - clocks to replace a quartz crystal.

Could resonate in RF frequencies

Switches for radar

Phased array antenna uses these.

RF signal can be switched fast.

David Roberts: Half a cm too big?

Definitely on large side. Max 200 microns. Never more than 50 microns thick.

If you built specific, could be assembled. Would need specialty rig.

10:05 Break.

Merkle: IR camera set up. Pointed at audience. Have fun. Break until 10:15.

[applause]

[great fun with IR camera:

white fingerprints left on side of cold beverage, front of shirt

Javier's hair is very black - still damp from shower

Air cond vent is very black

Bottom of laptop is white hot

Glasses show as black - they are mirrors to IR

Julielynn poses with her IR photo projected behind her

You can see her bra through her clothes!]

10:17 Merkle: Next speaker will be starting soon.

NT CL6 Positional Assembly (Ralph Merkle)

- Molecular nanotechnology

self assembly and

positional assembly

-Arranging atoms

Self assembly \u2013 molecular parts move at random and \u201cstick\u201d when complementary surfaces happen to meet

Positional assembly \u2013 molecular parts are held by molecular \u201chands\u201d and \u201cstick\u201d when reactive surfaces are pushed together

Voila, they stick.

- Solution-based chemistry

Reactants interact in random orientations

No \u201cpromiscuous\u201d reactants

Uses multiple weak interactions to achieve both strength and selectivity

Reactive environment (water) participates in many reactions

Solubility is critical

Dealing with reactants in random orientations.

Has some implications. Can't have promiscuous reactants.

Better not have things that liketo stick, they are going to stick in the wrong ways.

Have things that like to stick, but mutliple interactions, but if everything lines up perfectly, then they'll stick.

Multiple weak interactions.

Other thing, in a solution. Part of the processs. Water participates. It is active. Self assembly . Soluability is crucial. Better be in solution, if precipitated out, going \"thunk\" - can't have that. A lot of stuff has problem being in solution.

- DNA nanotechnology

Lot of neat stuff. We've had that talk.

Huge space, under active investigation.

- Examples:

alpha helix and

beta sheet in proteins

Protien folding. Designing proteins. Huge range of known, more understood every day. Whole range of things. Structures related to proteins and artificial things close to proteins. Range of things abstractly like proteins but easier to synth.

People studying for many years feel they have a handle on it.

De novo protein design - can do it for a function.

\"Here's a protein, what does it do?\" still a hard problem.

Possible to design proteins today - fit to purpose.

- Phospholipid structures

Lipid membranes. Everywhere.

Hydrophobic and hydrophilic (likes water), you find if you take them and throw them in water they cluseter in fairly charcteristics ways.

Micelle puts all the water loving parts exposed to water.

Works pretty good if you have a small amount.

Liposomes - oily parts on inside. Water outside. Inside water. Membrane separating the two.

Phospholipid - occurs in huge number of biological systems.

Oily layer on inside. Layer that likes water on outside. You find that this structure occurs quite naturally. Repeated - a common motif throughout biological systems.

- Molecular machines

Bacteriophage - inject DNA into cell T4

- Making proteins

The ribosome. Now beginning to represent a core concept in positional assembly, stringing together amino acids - not by self-assembly, but by positional assembly. Device which positions individual amino acids - growing chain is bonded not by self- but by positional assembly by being held in position by ribosome.

Perhaps the simplest example of positional assembly.

At the heart of programmable protein synthesis.

How many dont know what a ribosome is?

This gadget takes messenger RNA. Biological punched paper tape. Follows messenger RNA - chucka, chucka, chucka, chucka, chucka - grabs the transfer RNA with specific amino acid on it. Binds to previous one. Hangs onto transfer RNA, so this gadget can program a chain of amino acids.

you give it a specification and it makes that protein.

A programmable device.

At the heart of biological activity in all living organisms.

- Positional assembly

Now we come up to the concept of positional assembly.

We use our hands.

Has let us build everything in the room.

At the scale of atoms and molecule, same principles.

Scanning probe microscopes or related devices.

How do they work?

This atomic force microscope allows us to add or move an atom from a surface.

See, touch and modify a surface.

Such devices should also let us build up structures. Happening in the future.

- Bending stiffness

Want to get across one point:

Thermal noise causes positional uncertainty at the molecular scale

This uncertainty can be calculated if we know:

\u201cstiffness\u201d k

temperature T

Rattling of small molecules due to boucing around of thermal noise. Motion due to temperature. Temperature is caused by the motion of molecules and atoms. This positional uncertainty is a constant problem. If you hold a device - it is wiggling - Nature's Parkinson's disease.

We may have problems with this.

Molecular device will have uncertainty:

Caused by higher T. If lower T, less noise.

Better bracing. Thermal noise less.

Two critical factors: T and stiffness.

- Thermal noise

Equation.

sigma ^2 = k sub b T / k

k: restoring force

k sub b: Boltzmann's constant

What you plug in to make equation work

T: temperature

sigma: mean positional error

- 2 (with numbers)

10 N/m for k.

What is 10 newtons per meter. if you pull tip aside by 1 m, it wil have a restoring force. More you pull, more the restoring force.

Bigger the displacement, the larger the force.

Only pull a little bit, small force.

10 is a pretty reasonable number.

10 N/m is reasonable in scanning microscope context.

Can have much smaller restoring forces.

Boltz: 1.38 x 10 ^-23 J/K -- can't play with this

T:300 K is room temp

sigma: 0.02 nm (0.2 angstroms)

possible to have molecular device which can position to within a fraction of an atomic diameter.

If someone says, \"Positional assembly is not possible\" you can now argue not only from biology, but you have equations which prove it is.

Gee. it looks like we can have molecular machines.

Questions. Pretty core point. That's why i'm hammering on it with several slides.

Q: how controversial?

Used to get a lot of flack? Anything recent? Been several years. Maybe I should give up countering it. Last year's battle. Still some arguing against it somewhere. Still habitually arguing. Old habits die hard.

- Example

Experimentally. i've shown this? Yes.

We can arrange on surfaces

- The goal

Nature has given us this set of lego(R) blocks.

Some of them blow up quickly. Lot of those we need to be careful.

Stable isotopes common in nature are available.

Different price tags. Perhaps use less of the expensive ones.

like to be able to arrange those in most of the ways permitted by physical law. That's what we want.

- Three elements: H, C, Ge

Fewer elements makes the problem easier to analyze and easier to do

H and C can build almost any rigid structure (diamond, lonsdaleite, graphite and graphene, carbon nanotubes and fullerenes, polyynes, other hydrocarbons)

Ge provides \u201cjust enough\u201d synthetic flexibility

A simpler model - focus on smaller number, understand them well. Build large number of things. Rob and I focused on three. H, C and Ge. If actually trying to go through all the reactions, limiting the elements is helpful.

Hydrocarbons let you build a whole bunch of useful stuff:

diamonds

buckyballs

the latest major breakthrough in labs - graphene

polyines - whatever they are, they're great

Whole bunch of really valuable stuff just from hydrocarbons

If only capability we had, that by itself would revolutionize manufacturing.

Then we threw in Ge since it was hard to get H and C.

We just seemed to need Ge. You had to be there. Couldn't figure out how to make it work. Maybe could have done it without Ge.

-What to make

Property Diamond\u2019s value Comments

Chemical reactivity Extremely low

Hardness (kg/mm2) 9000 CBN: 4500 SiC: 4000

Thermal conductivity (W/cm-K) 20 Ag: 4.3 Cu: 4.0

Tensile strength (pascals) 3.5 x 10^9 (natural) 10^11 (theoretical)

Compressive strength (pascals) 10^11 (natural) 5 x 10^11 (theoretical)

Band gap (ev) 5.5 Si: 1.1 GaAs: 1.4

Resistivity (W-cm) 1016 (natural)

Density (gm/cm3) 3.51

Thermal Expansion Coeff (K-1) 0.8 x 10^-6 SiO2: 0.5 x 10^-6

Refractive index 2.41 @ 590 nm Glass: 1.4 - 1.8

Coeff. of Friction 0.05 (dry) Teflon: 0.05

Source: Crystallume

Diamond is wonderful

Bigger band gap

Pick any property and diamond is either best or near the best.

Gravitate toward diamond.

Exception: throat of a rocket. Diamond burns. Not ideal there.

Wonderful material for almost anything.

this is why it is fantastic.

Could arrange it in all kinds of shapes.

- Making diamond today

Chemical vapor deposition.

Some highly reactive plasma. all kinds of reactive stuff.

Lots of H.

Reactive C.

over a growing diamond film.

- Diamond growth

Diamond CDD - swiped from group in England.

Add CH4.

Diamond 1oo surface. Bit of diamondin red.

Now we focus in on those C atoms and see an atomic H flying in from that plasma. Slams into H. Sometimes will bond to make H3. That flies away into plasma. Result, C with dangling bond. Officially \"unhappy\" Chemists say, \"open shell\" etc.

THEN you get highly reactive CH4. Notice 3 H atoms. Recall from chemistry that C likes to have 4 bonds. IT is unhappy. Flying through plasma. When one unhappy C meets another unhappy C they bond and become happy.

The wonders of chemistry.

One way growth of diamond happens in diamond CDD.

- Postional assembly

NOW the interesting bit. Suppose we want to build diamond with control

A strategy for the synthesis of diamondoid structures

Positional assembly (6 degrees of freedom)

Highly reactive compounds (radicals, carbenes, etc)

Inert environment (vacuum) to eliminate side reactions

So what we want to do is positionally controlled.

Same or similar sequence with molecular tools to accomplish simliar result.

Now we have again, small fragment of a surface. Bring in a tool, highly reactive. Not a H atom. But it is highly reactive.

These two H are

This C wants to form one more bond. It has in its heart a deep lust for a H.

It has a higher affinity for any structure other than Flourine.

So this C atom has a higher affinity for H than this (further back) C atom,

the H pops off.

If we are to believe computational chemists, the barrier is zero or close to zero. Should occur readily at almost any temperature.

Recall how H3 goes flying off.

Here H removed, radical site on the surface, creating a synthetic analog for the natural process.

Now we bring in a seond tool ... [what happened to the color coding ralph?]

Ge is big and plump and soft.

Soft squishy - this C has two H and one Ge. Unhappy with 3 bonds.

This one on surface is unhappy.

C that was unhappy bonds - nice strong bond between C atoms.

Now, when you pull away, C-Ge breaks, and you are left with an unappy C.

Finally you come in with a H donation tool. H bonded to Ge by soft squishy weak bond. H prefers strong bond to C. Jumps to C. Tool,then withdraws.

Left with C bonded to C - with 3 C on it- jsut as in natural analog.

Done with tools. At specific location. Carried out analog of natural diamond growth in a controlled way. Repeat. Build precisely what we want.

Those three slides are at the heart of what I am talking about.

Remember those three slides.

Did they make sense? Questions?

Emiliano: Diamonds in nature take ages. Vapor takes time. How fast for this?

Actual chemistry - the reaction here will take picoseconds. Motion of tools could take much longer. Drexler estimated microsecond.

Speed of scanning probe - much longer - minutes for existing tools, seconds for future gen tools. Conceptually very clever down to microseconds.

other time you might be talking about - one atom at a time - a lot fo positioning of atoms. There the answer is do it in parallel. If sufficiently parallel you can do it as fast as you want.

Systems description coming in future lecture.

Q: How precise can you position tool with respect to molecule.

Love this audience. right on. This tool is going to have to abstract this H. If off, you are building the wrong structure. This is 2 angstroms. If off by an angstrom - forget it.

Depending on tool, strucutre, a half to quarter of angstrom is required.

Can we get that?

Scanning probe microscope - can see fraction of an A.

We have tools on order of these things.

Another very good quesiton.

Do we have necessary accuracy? Yeah. We do.

- Molecular Tools

HAbst, etc.

HAbst HDon GM Germylene Methylene

HTrans AdamRad DimerP GeRad

- Tool properties

Starting from small feedstock molecules, a set of tools can:

make another set of tools

recharge all tools

make stiff hydrocarbon nanorobotic devices

- H recharge

Recharging HAbst and HDon

(initial approach of first GeRad optimized by Tarasov et al (2007), -0.43 eV with -0.1 eV barrier)

Second GeRad abstraction -0.83 eV

Start on left. H Abstraction tool brings up H.

Bring it up, bond weakened. Bring second tool up. Bond with Ge. H will go away. Now, if you pull this Ge away -- if you pull these two tools apart, something will break. CC triple bond will not break. CC single bon will not break. This C has 3 bonds. this Ge has 3 bonds. So C-Ge is weakest bond and so it breaks.

Q: How do you pull? Would you lose traction?

Structure is much larger, robust.

Robotics question.

Q: Done in vacuum.

not protein engineering with this.

People get confused - in solution right?

Whole learning curve to get notion of \"held\" molecules.

Takes awhile to absorb.

Different along one axis OK.

If differnt along multiple axes, you are on the ceiling. Strange.

But it actually happens.

- Inputs/Outputs

100% process closure

9 tools

Can use C2H3, Ge2H6 as feedstock

Or use germanium surface for

C and Ge feedstock presentation

Six(?) degrees of freedom positional control

Might be able to get away with less.

- Technical Details

A Minimal Toolset for Positional Diamond Mechanosynthesis

Journal of Computational and Theoretical Nanoscience Vol.5, 760\u2013861, 2008

by Robert A. Freitas Jr. and Ralph C. Merkle

Bibliography of over 50 references on mechanosynthesis at

/Nanofactory/AnnBibDMS.htm

- Experimental

Philip Moriarty, University of Nottingham (U.K.)

Five-year \u00a31.53M ($3M) grant, August 2008

Investigate Freitas/Merkle DMS toolset

/Nanofactory/Media/PressReleaseAug08.htm

- Hydrocarbon universal joint

- Hydrocarbon bearing

-

- Molecular robotic arm

Build tools to build more robotic arms.

11:24 [applause]

Erez: How abundant is Ge? Will it be a needed commodity?

Ge in these devices would be a \"vitamin\"

H and C are fairly common.

Silicon is very abundant. Sand. Useful construction material.

One might wish to build out of sand. Computer chips, for example.

Erez: So sand will become expensive and diamond will become cheap? [;-)]

Lots of sand.

Lots of C in the atmosphere.

Emiliano: Bootstraps. Something that scales.

how do we get this process rolling.

Focused resources. Money. Focus.

Possible to take large sums of money and make it vanish.

If you have a focused effort, possible to achieve remarkable things.

From technical perspective, some high precision device.

Paper required reactions.

Whole bunch of research along that line.

collaboration website lists chalenges.

Davidad: Suppose you just want diamond skyscraper?

If you can build it with atomic precision, you'll get better materials properties.

I need to describe materials we cannot build - things on margin of

Nanotubes.

Outrageous materials beyond our capabilities - simply notin the cards.

On-board computers, on-board communication. Sensors/communication abilities.

Respond to environmental changes.

Can take blows. Much more responsive.

Take alook at nanotubes. Imagine they were cheap. Much lighter, stronger, higher loads. Even lower cost would have a big impact.

Look at NASA's need. PhD on impact of low cost, light weight, drops cost of getting to LEO by orders of magnitude.

Q: Briefly mentioned ribosomes. orthongal translation - other polymers?

DNA encodes information, also has other requirements. Not perfect information storage. Perhaps other would have higher density, not require water around it.

DNA is actually quite good. Wow. Lot of information in a fairly small number of atoms - compared to today's disk drives.

Big gap between disk drives and DNA.

We can probably beat DNA.

Q: About DNA. At the moment. 3 nucleotides. 20 amino acids. Increasing to 4 - lot of new protein structures? Jump ahead for nano in biology?

I don't follow that closely. Could redesign ribosome in new ways.

3 codons specify. Right now you could remap, specifiy more amino acids.

Appears feasible. Current capabilities could do that if worthwhile.

Right now, genetic engineering folks have a whole range of options.

I wouldn't dream of telling them what to do.

Venter has been doing a whole bunch of interesting stuff.

New bacteria from genome typed on computer. Whole range of possibilites.

Whole bunch of people interested in those things.

Going over now. Have to cut myself off as the moderator of myself.

11:36 [applause]

Question from backchan.nl:

Question for Ralph - How pure / clean do the source materials (hydrocarbons) need to be for nano machines? How far are we from being able to shovel in crude material and have nano machines come out the other end?

Chris Lewicki

TP Space

Salim: 2 minute break. Introduce John Gage.

11:42 Getting started.

11:44 John Gage

How do you encode information in small spaces.

Use material to store information.

Late 40's. Ideas - using magnets. bits of wire.

Claude Shannon

Evolved with people making things

How would you do a program to follow instructions.

Lady Ada, Babbage.

Loops, instructions, algo

Working on themselves

Making things. Ralphs world, same ideas hold.

Encoding lots of information.

When thought of what woud be interesting to you -

apply algo to physics

do what differential eq

Maxwell

Let design system help a human.

Copper big, today small.

How much current flowing through will melt it.

If you let system guide you, it is useful.

Now in synthetic life.

Multiplicative power of combinding computers and humans.

Things we didn't undersatnd in 4050/60s. Maybe a bit of 70s.

Make books by links. Out of Belgium. Microfiche. Nothing new.

What is new, billions of people interact wih each other cost free.

Form of interaction with physical world.

Never could \"see\" before.

Just seen things never seen before.

CAD allowed seeing things you couldn't see in VLSI.

In designing talks, pose a platform for questions.

Above computers, logic -- how does this change us as humans.

Extend our understanding, join human intelligence.

Consider new questions.

None of us really have answers.

Next 8 weeks, want to be able to talk with you.

We will be here - will drink wine -an organic compound used in science to make things happen.

I have used a test case to see how applicable this could be.

Try living in aworld with no electrons. Farming with rain fed agriculture.

you are 1 billino and a half people. Not all people getting so much smarter.

Had a meeting with guy who runs China Mobile. He's quite happy. 550 mil internet subscribers. Did something - remotest parts of china have internet access. Could not do in any less succssful company.

Imagine we are Wong of China. What could this do as social being to collaborate together.

11:51 Salim: Thank you John [applause]

Kevin Marks will talk about open standards.

Chief evangelist for Google open social.

Social networks an dopen standards.

Kevin: Two presentations.

Ideas from social

Go through quickly

- [Prezi] Open, Social Web Standards

/wiki/OpenSocial

[/256/ - map of social networks]

About a billion users have implemented standards.

/wiki/Openid - requires URL

[ref] uses e-mail to get to URL

\"a phatic expression is one whose only function is to perform a social task, as opposed to conveying information\"

/wiki/Phatic

Activity streams

[ref Salmon]

/wiki/Salmon_(protocol)

Delegated login. Choose where your home is. Information can flow back to places you are interested in seeing it.

To do this, we need permission. Difference between permission and consent.

Standard called OAuth [ref]

/wiki/Oauth

Examine universe. What have people built. How can we make them interoperate: microformats.

/wiki/Microformats

Reusing HTML. Agree we will call this the same thing.

Distinction from programmer's perspective. You feel like a bespoke tailor. If we agree on standards, we can just make t-shirts. May not fit like a suit, but much cheaper.

Working out the social politics of who you can trust and why ...

Hubristic premise of social sites: we can arrange social interaction.

Most of our cerebellum is aimed at social interaction. Lots of neurons - about as many as there are nodes on the internet. So it will be awhile before the internet will catch up to our capabilities.. (Maybe sacriledge here at SU).

[second presentation]

Stocks and flows in social world. Idea is you are part of a flow. Living inside the stream, in it,

danah boyd [ref - quote]

If you've got face next to piece of information :-) you respond to that.

I trust Chris to recommend a restaurant. We have very nuanced models of people in our head.

Trust / Friendship /Context - rather than replicate in computer, just use faces to leverage brain.

Modifications to that - retweet - unfamiliar faces showed up, made people uncomfortable.

- Phatic - not carrying information.

Kind of social grooming like monkeys do.

Behavior makes much more sense.

People sending emotions to each other.

google is to machine

Twitter is to a human

Took someone oxytocin 13% higher - feeling loved from using Twitter.

Who cares what you had for lunch? my mum.

Low information content matters to someone.

By viewing these emotional updates, get a much better social sense of the person.

- Following Power Parasocial

Classic model. If I know your name, I can annoy you.

Later 200 people you don't really know.

\"Is this person your friend?\"

Lot of second order behavior. Because un-friending is so harsh.

Say, \"Oh, I forgot password. Did I lose you? Blame technology for social machinations.\"

- Semi-overlapping Publics.

Used to be only one paper of record.

Metastasized with large media organization.

Every document creates its own public.

Something bumping into quite strongly.

Not trying to address whole world - massive shift.

danah - \"idea of public is not about all people across all space and time. They want publics of peers, not publics where creeps and parents lurk\"

Just because something is on the internet does not mean it should be on TV.

- Democratization - Mutual Media

Choices made used to be important.

Now mutual. All looking at a bunch of things, acting as a filter.

We are neurons in a global brain

Fear was internet will choke us in information.

Each of us is a filter for everyone else.

Collectively better information.

Personal information.

Watch how people use networks.

Apart from personal / emotional stuff, it is \"I found this interesting\"We are getting more intersting view of world than when it was filtered for least common denominator.

- Small World Networks.

With real world networks, mostly local. Few long range connections.

6 degrees [ref]

Exponential law of connectivity. Look at lnumber of links vs. frequency, you get 1/x type of curve.

Only historic accidnet that we use top of curve.

Ties to mutual media idea. Information will pass through, whereever it starts from.

- Homophily.

Out-gorups

Minimalgroup paradigm.

Start with family. Associate with people like us.

Out-groups - attack and make fun of them.

Examples:

Oliver James on Twitter in London Times:

bit.ly/wolff_myspace

bit.ly/mash_orkut

Biggest social network in Brazil and India

Different social networks as different nations. What is actually happening here, I think, very similar. Bumping into pre-existing cultural barriers.

With Orkut - expand to fill - different feel.

LiveJournal in America - large, teen golf? feel.

- Tummeling

Not an English word for this. The person who catalyzes conversation.

Who makes it non-adversarial.

Geisha.

Americans thought I meant hooker.

\"WebKit is a layout engine designed to allow web browsers to render web pages. The WebKit engine provides a set of classes to display web content in windows, and implements browser features such as following links when clicked by the user, managing a back-forward list, and managing a history of pages recently visited.

WebKit was originally created for Apple's Safari; used in Google's Chrome Browser.\"

/wiki/WebKit

\" HTML5 is a standard for structuring and presenting content on the World Wide Web. The new standard incorporates features like video playback and drag-and-drop that have been previously dependent on third-party browser plug-inssuch as Adobe Flash, Microsoft Silverlight, and Google Gears.\"

/wiki/HTML5

\"XFN 1.1 introduced the \"me\" rel value which is used to indicate profile equivalence and for identity-consolidation.\"

/wiki/rel-me

Q: How can we make the time people spend on social sites more preductive?

A: It's part of the challenge. It's better that people are updating their facebook profile and half listening.. More information is worse argument keeps coming around but we keep finding ways to help it. Email has its own challenges and problem. My sense is that the better employers are those that are paying attention to the outside world. Blanket firewall to these sites are a mistake.

Q: I'm a skeptic of oxytocin. I would like to see more research

A: The reason people are spending hours a day on these sites is because people are feeling real connections there. BLOGher (/conferences), get females together to talk about problems. I went to first one of those, amazing emotiona

l experienced it. Giggling, standing around. To say you can't build an emotional connection there I think is wrong.

Q: How much will this allow us to create a financial identity on the web? Sharing information with vendors?

A: There are many sites designed around this. I think we are going to see more of this. Funding in silicon valley is a socially mediated area - it isn't systemitized.

Salim:

For the first time in history, you can get to know someone without even meeting them.

[JG: my daughter, at school in London, met and married a guy from Pakistan - over Skype]

There are three ways to exchange information:

1/ messaging (email, postage),

2/ request response (can i have your business card, search engine, A->B, B->A),

3/ subscribe (one question, many answers, when are you free?, financial industry) These are archetypal and exist in all levels of computers.

What we've seen over 20 years on computers is that these patterns have layered themselves on the internet. 1990's, request response developed (web pages). Took 10 years to implement. Now we are at the latter part of the third stage, RSS. Tell Twitter to tell you whenever your friends do anything...

Next layer is the sensor layer, the internet of things... Multiple sensory devices publishing more and more information onto the web - the nervous system for the world. Search is like the memory.

Remember that information flow in team projects will follow these patterns.

=============== DURING-presentation notes

Can't stand the colors of Etherpad? Turn them off with Pad Options.

(Note: this changes the color for EVERYONE.)

Color card definitions:

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Link to backchan.nl for questions:

http://singularity.backchan.nl/meetings/view/152 First speaker

http://singularity.backchan.nl/meetings/view/153 Second speaker

http://singularity.backchan.nl/meetings/view/154 Third speaker

GSP10 Book List:

http://bit.ly/GSP10BookList

=============== POST-presentation notes

Instant Evaluation:

/viewform?formkey=dGVzY3JzR3VFeTJjSElVcjM3REFpY0E6MQ

Pads are ready for the afternoon Team Project sessions:

/tpenergy-Jul9-Team-Meeting

/tpfood-Jul9-Team-Meeting

/tpspace-Jul9-Team-Meeting

/tpupcycle-Jul9-Team-Meeting

/tpwater-Jul9-Team-Meeting

"

/core-Jul16-NT-afternoon

"7/16/2010

Friday

2:30 - 5:30 pm

NT Session: Applications of Nanofactories

Merkle

Slides: http://bit.ly/cU9TXY

Videos at: http://bit.ly/dBceUV

2:37 Recitations from Lord of the Rings.

Do we have any other requests from the audience.

A bit of housekeeping: a molecular modelling workshop.

In order to do the workshop, we plan to load some software -

HyperChem

onto everybody's laptop.

Demo will be good from Monday until Aug 13.

For Windows is 243MB. For Mac similarly large.

We've got a copy of the Windows version.

If you want, download either the Windows or Mac version from their website.

When you get it, install it. You'll have to run it.

It will want a license. Give it a fake one.

After awhile it will give you a lock in code or something.

Write that down.

Send an e-mail to hypercube.

They actually respond slowly.

Then when you get it ... load into HyperChem

Don't wait until day or two before workshop and it will not work.

Did this last year and that's what happened.

Go ahead and do it at some convenient time.

A week or two before the workshop.

You can play with the software.

....

Also models of bearings, gears.

IBM site visit coming up.

You have already made that choice.

8:00 am It is worthwhile.

last year the folks who went loved it.

IBM site visit will be great.

We'll be talking about the applications and the purpose, mostly an open lecture, interaction format.

Purpose is to convey to you, by going through examples, the impact this technology is going to have in a huge number of fields.

Normally when people say \"HUGE\" they mean a small change.

Totality of impact.

Words fail me.

Words do not work.

All words used. They just don't work.

You'll see, as we go through them, the kinds of impact this technology is going to have.

You'll say, \"Do you mean X?\" And I'll say, \"YES, I do mean X.\"

- Impact

The impact of a new mfg tech depends on what you make.

Molecular nanotechnology

Applications of nanofactories

Impact

- Computers

Medicine

Space

Environment

Agriculture

Computers

Computer chips have a thin (a few microns on top of ~1,000 microns) layer of active computing elements \u2013 the rest is just support

Cost for this thin active layer is well over $1,000,000 / kg

- Computers

*A one kilogram molecular computer with ~10^18 logic elements might cost a few dollars.

*It could operate at 1 gigahertz and dissipate ~3,000,000 watts (using irreversible logic) or much less (a few watts) using reversible logic.

*10^27 logic operations per second is roughly the brain power of 10^11 humans.

If you reduce energy consumption - see fundamental limits of computation - you can drop 3 orders of magnitude. A few kW in a few kg. You can probably do that. Yeah, it will be running hot. Probably get that much computational power.

To get the flavor of that - roughly 10^11 humans, ballpark, hardware.

How many on planet today, 10^10. Ballpark, we're talking 10x the human population in one computer.

I'm not an expert in AI. Things are getting better. We're going to do all kinds of interesting things. Oh, and don't forget that this is a few kW of power. How much will we have -- a whole bunch.

Raw computational power is going to be large. Very large. You can get larger numbers by looking at the amount of power that is going to be available.

If we dedicate some chunk of power to computers, then we will have large amounts of power, multiple orders of magnitude greater than the entire human species today. Interesting.

- Medicine

Respirocytes

Exploratory Design in Medical Nanotechnology:

A Mechanical Artificial Red Cell

Artificial Cells, Blood Substitutes, and Immobil. Biotech. 26(1998):411-430, by Robert Freitas

Scenario: Call doctor, \"My heart has stopped.\"

- [Animation of artificial blood cells]

Maybe a micon in diameter. Float around in bloodstream. They release Oxygen. Control of release. Image of what an artificial red blood cell would look like.

- Power

How would you power one?

H in one side. O in the other.

Membrane allows protons through.

Glucose fuel cell would be very useful. Hard to make a good Proton Exchange Membrane. Would block electrons, pass ions.

Already building today.

- Glucose/oxygen fuel cell

C6H22O6 + 6O2 --> 6CO2 + 6H3O + energy

PEM (Proton Exchange Membrane)

Passes protons but not electrons

Nanotechnology will enable manufacture of PEM\u2019s a few nanometers thick with highly selective proton pores

And catalysts

Neutrophil Chases and Eats a Staphylococcus aureus Bacterium

(from 16mm movie by David Rogers, Vanderbilt University, in the 1950s)

- Medicine - microbivores

Neutrophil Chases and Eats a Staphylococcus aureus Bacterium

(from 16mm movie by David Rogers, Vanderbilt University, in the 1950s)

-

Robert A. Freitas Jr., \u201cMicrobivores: Artificial Mechanical Phagocytes using Digest and Discharge Protocol,\u201d March 2001; /Nano/Microbivores.htm

Sweeps in bacteria. Chops it up and poops it out.

So these devices would be able to repond, very rapidly, very effectively - even infection beyond where current methods could treat it.

Output would be harmless.

Normally a white blood.

Q: Would viruses be too small?

So long as virus can be identified.

Q: How can it get pathogen not blood cell.

This one would be specific to a pathogen.

Or, have programable binding sites.

Q: Dialysis - outside the body.

Yes. Could treat blood outside body.

Q: Application to targeting tumor?

Yes. if you can identify.

Not yet had as much success as you'd like.

If cell has antigen - selectively disrupt them.

Utilize product.

Q: Would it not get attacked by the body?

If not designed correctly, yes.

Might have to do something careful.

If you do it right, you should be ok.

- Medicine - chromallocytes

Assumes there is some navigaton.

Go to cell at that position.

The Ideal Gene Delivery Vector: Chromallocytes, Cell Repair Nanorobots for Chromosome Replacement Therapy

J. Evol. Technol. 16(June 2007):1-97; /v16/freitas.pdf

by Robert A. Freitas Jr.

Everybody would like to have this technology in 50 years?

How many would like to be alive at 200 years old with high quality of life?

Seems to be a disjunction between what is expected and what is wanted.

- A revolution in medicine

Today, loss of cell function results in cellular deterioration:

function must be preserved

( the fundamental medical imperative today )

With future cell repair systems, passive structures can be repaired. Cell function can be restored provided cell structure can be inferred:

structure must be preserved

Today, cells repair themselves.

If it is no longer functional, than it cannot repair itself.

It is on a downward spirial.

If you can repair structures, then you can restore a cell so long as the structure is still there.

- Medical research

Future descendants of SPMs could rapidly scan the surface of cryofixed tissue with molecular precision

*Electrostatic

*Van der Waals

*Conductivity

*Many others

Very small scanning probe microscopes will be able to explore tissue.

- Surface scan

\"freeze fracture\"

A \u201csticky\u201d probe could remove individual surface molecules

*Carbene

*Boron

*Metals

*etc.

- Cryonics

From 98.6 degrees F, down to -320 degrees F. Revive decades later.

/cryonics/cryonics0804.pdf

- Frozen Kidney and Vitrified Kidney.

Water tends to form ice. So you want to avoid formation of ice.

In vitrification, you introduce ice blockers and cryoprotection.

You cool and do not form ice.

/wiki/Glass_transition

- Cryopreservation

Cryobiologists are often asked how long cells can remain viable at -196 degrees C, the temperature of boiling liquid nitrogen (which is the usual cryogenic fluid). The answer is clear \u2014 more than 1000 years.

Peter Mazur

Stopping Biological Time: the Freezing of Living Cells. Ann. N.Y. Acad. Sci. 541: 514-531, 1988.

- Restoring health

This is what digital restoration can do:

Nanomedicine will let us digitally restore you

/wiki/Do_not_resuscitate

- The choice

Do you want to join

the control group

or

the experimental group?

When phrased like this, you get, \"Oh, when you put it that way ...\"

-Space

Big impact by simply reducing the cost and the strength to weight ratio.

- Space

How big an impact can we have.

*Launch vehicle structural mass could be reduced by about a factor of 50

*Cost per pound for that structural mass can be under a dollar

*Which will reduce the cost to low earth orbit by a factor of better than 1,000

/nanotech/

NASAapplications.html

- Space

Other thing, if you want to put something into space -

the weight per unit function -

say, a computer, but that computer is now lighter

with lighter, more precise materials,

I can reduce the mass that goes into orbit.

*Light weight computers and sensors will reduce total payload mass for the same functionality

*Recycling of waste will reduce payload mass, particularly for long flights and permanent facilities (space stations, colonies)

- Space

*SSTO (Single Stage To Orbit) vehicle

*3,000 kg total mass (including fuel)

*60 kilogram structural mass

*500 kg for four passengers with luggage, air, seating, etc.

*Liquid oxygen, hydrogen

*Cost: a few thousand dollars

K. Eric Drexler, Journal of the British Interplanetary Society,

V 45, No 10, pp 401-405 (1992).

Molecular manufacturing for space systems: an overview

If you run through the numbers, you find SSTO - 3K kg including the fuel with 60 kg structural mass. Delightful numbers with molecular nanotechnology. 4 passengers with luggage. A VW bus. Runs on liquid O and H.

Everybody has access.

Everybody can go there.

You have fun.

- The rocket equation

Has Dan Barry been discussing this?

Exhaust velocity is big thing. You want this higher.

Way you get more exhaust velocity - problem with chemical energy is it is awful, pathetic. First thing - get energy from sun - solar electric ion drive.

Soak up energy from the sun. You can get as high a velocity as you want, just soak up more sun.

With molecular mfg technology, you can have really thin solar cells.

Excuse me, he is using aluminum reflectors.

delta V = v sub e ln (M sub i/M sub f)

Where

delta V is the change in rocket velocity

v sub e is the velocity of the exhaust gases

M sub i is the rockets initial mass

M sub f is the rockets final mass

(Tsiolkovsky, The Investigation of Outer Space by Means of Reaction Apparatus, 1903)

- Space

*Solar electric ion drive

*Thin (tens of nm) aluminum reflectors concentrate light

*Arrays of small ion thrusters

*250,000 m/s exhaust velocity

*pretty respectable!

*Acceleration of 0.8 m/s2

*Earth\u2019s gravity is ~9.8 m/s2

*Tour the solar system in a few months

K. Eric Drexler, Journal of the British Interplanetary Society,

V 45, No 10, pp 401-405 (1992).

Molecular manufacturing for space systems: an overview

A one-two punch. You've now got access to the solar system at a reasonable cost. Whoa. Space is available. All of this depends on molecular mfg -that looks interesting. Space is opened up.

And do complete recycling.

Go there. Hang out and have fun.

- Space

Project Orion

Really neat

Answer to the obvious question.

I want to use nuclear power for my rocket.

How do I do it in a simple way.

You know those 1950s movies with the big roomy rockets.

Storage area. Ladder.

Bunks for everybody.

HUGE.

Giant.

With project Orion you can do it.

For fuel, you had a bunch of atom bombs. 100, 1000.

What they called a push shield and some really big springs.

Bomb would blow up. Absorb explosion. Then throw another bomb out.

That's how it would work.

People were building these in the 1950s. Use it for nuclear powered flight.

Lot of energy in an atom bomb.

- [ video 15MB http://bit.ly/b2laeb ] Note: this and other NT videos available at http://bit.ly/dBceUV

Nuclear test ban treaty was hard on this project.

Project Daedalus (British Interplanetary Society) used exploding fusion pellets in their 1978 study.

Q: About 100 articles on interstellar space travel.

Modify Orion with a single explosion. Go 2 miles down. Set off bigger bomb. Create a nuclear cannon.

Could have been done in 1950s.

- Space Elevators

Large amounts of very light strong materials.

On Earth. Cable would hang there. Elevator would come. You step on. Press UP. It would go up. It would continue to go up. The surface of the Earth would fall away. Sky above would become darker. You'd become lighter and lighter. You'd reach Geosynchronous orbit and be weightless.

Cable is in tension.

Also beanstalks, space bridges, space lifts, space ladders, skyhooks, orbital towers, and orbital elevators.

First described in 1895 by K.E. Tsiolkovsky in Speculations about Earth and Sky and on Vesta.

Q: If a lot of mass was moving up and down, effects?

If you go up and down, OK, but if you keep going, you are plastered against ceiling. At the end of the cable, you are hanging on for dear life and, if you have timed it right, you let go and go flying off to Mars, or wherever.

A charming device.

- Space Elevators

You really need strong materials to make this work.

Ribbon taper ratio versus specific strength.

Assumes a lifter mass of 1,000 kg and a safety factor of 2.

Cross sectional ratio -

Diamond is somewhere between 30 and 40 MPa m^3/kg

This thing is exponential.

Your taper wafer goes through the roof.

Steel doesn't work.

Probably need something remarkably well structured.

This will really be pushing your materials right to the limit.

Need something to deal with inevitable radiation hits.

Start to have failures, dislocations, why don't they take whole thing out.

Need some mechanisms.

Idea has caught on.

Next one in August 13 at Microsoft conf center in Seattle.

/wiki/Space_elevator

http://spa/default.aspx

Airplanes

Terrorists

- Space Pier

Hasn't been discussed as much.

A building just above atmosphere.

Linear induction motor - and you are accelerated up to speed and you are in orbit.

Lot less expensive than elevator.

/~josh/tower/tower.html

Build a structure 100 kilometers tall and 300 kilometers long. Put a linear induction (or other electromagnetic) motor along the top. An elevator goes straight up 100 kilometers to the starting end. Payloads are then accelerated horizontally into orbit with an acceleration of only 10 G's (which appropriately cushioned humans can stand for the 80 seconds required).

Josh Hall

- Solar Sails

Rocket equation is a real downer.

Limits performance to exhaust velocity.

Terrible.

Solar sail is nice because you are no longer carrying your fuel and reaction mass.

Bounce light off a sail.

Make big sail. Make honking big laser.

How big?

A little fuzzy.

But if you have a replicating base.

Go into asteroid base.

Soak up solar output.

Point the laser at your solar sail. Now powering your solar sail at /wiki/Alpha_Centauri

- Ultimate recycling

*Sealed worlds

*Nanotechnology will enable total recycling in even a small sealed colony in space.

- O'Neill colonies

/wiki/Gerard_K._O'Neill

/wiki/The_High_Frontier:_Human_Colonies_in_Space

I'd like one with half spin so I'd be half as heavy.

You can go hang gliding down the middle of these things ...

You can convert available raw materials into what you want.

- Dyson Spheres

Enclose your sun.

/wiki/Freeman_Dyson

- Max population of solar system

*Solar output is ~3.8 x 1026 W

*Humans use ~100 W

*Throwing in a factor of ten margin implies

The solar system could support ~3.8 x 10^23 people

About half a mole of people.

That considers the limiting factors.

People as we currently understand them.

Examination of Earth's population - historically.

Each author, over multiple centuries, concluded Earth could support about twice the current population.

Then one author proposed limit - somewhat higher.

Earth is a sphere.

If we assume that cooling equipment can operate at cherry red temperature, the maximum carrying capacity of the Earth is that level that would cause the Earth to glow cherry red. 10^18 or something. A reasonable limit.

- Fermi\u2019s paradox: [ skipped ]

Interstellar flight is possible, so

where are all the space aliens?

- Human impact on the environment

Population of earth

*Living standards

*Technology

*Environment

- Environment

Greenhouse/hydroponic agriculture

*10x increase in yield per acre

*Looks like it is in the cards.

*10x reduction in habitat destruction

*Known methods (nutrients, CO2, temp, humidity, pests, weather)

*Plant heaven

*Better implementation at lower cost

- A higher standard of living and

a smaller environmental footprint

- Feeding people

*Today, one American uses ~one hectare (10,000 square meters) of farmland

*One person needs ~10 megajoules/day

*That\u2019s less than the sunlight on a one square meter roof mounted solar panel

*Four orders of magnitude improvement is possible in principle

*Synthetic nutritious food

Simply provide nutrious food - that everyone recognizes is good and acceptable.

- Solar power

*Sunshine provides ~10,000 times total world power usage.

*This is a shifting number.

*Molecular manufacturing will let us make efficient, rugged low cost solar cells and energy storage.

*Another area where we will find a shift. People working on this already. Other technologies may make this happen first, but molecular technology will keep the momentum moving forward.

*Use of coal, oil and nuclear fuels could be largely eliminated.

*If they create issues, we will just migrate away from them to something which doesn't create problems. But, at some point, we are going to have more alternatives we can use and no longer be limited.

- Atmospheric CO2

A big one. Right now we have a problem. People are annoyed by the amount of CO2. A lot going into the atmosphere. A variety of things in the atmosphere it would be good to be able to adjust.

*CO2 emissions are similar in magnitude to steel, concrete, wood and plastic usage

*Structural materials could be replaced with hydrocarbons (plastic, variants of diamond, graphite)

*Structural hydrocarbons sequester carbon

*See also Robert Freitas, \"Diamond Trees (Tropostats): A Molecular Manufacturing-Based System for Compositional Atmospheric Homeostasis,\" IMM Report 43, 10 February 2010; /Reports/rep043.pdf

- Remediation

Toxic sludge

is made

from atoms!

You can deal with the rather disgusting messes we have by rearranging the atoms.

So major issue becomes, what do you like?

Increasingly a shift from what is possible to which option do we prefer?

More decisions to make.

- Nano talks

\x3cField> is critically dependent on \x3cproducts>.

\x3cProducts> are made from atoms.

Nanotechnology will let us make \x3cproducts> that are lighter, stronger, smarter, cheaper, cleaner and just better.

This will have a huge impact on \x3cfield>, for example, we could even make \x3cproducts> that are \x3castonishing parameter> and cost only \x3cremarkably little>!

Finally, I am going to reveal the secret to giving a nano technology talk in any field.

[laughter]

4:44

Everson: How nanotech working with waste/recycling?

Basically the observation is that waste is atoms arranged in the wrong way.

Put it into a system that will digest it. A digestion system that will take molecular structures,

with a high enough level of energy, it will look remarkably like digestion.

Throw it into a stomach.

Even isotopic separation becomes feasible.

Separate out the radioactive part rather than contaminating everything in sight.

Periodic table consists of a relatively few elements.

Q: Steve Cronin: How often are the nano claims true?

This is true remarkably often. Particularly where there is a device.

Q: Nano and biotech merge?

Yes.

Interesting question whether biotech can stretch to make diamond.

At the moment they are separate.

Whether they stay separate will be interesting to watch.

JG:Macro objects? Put \"Construction\" in as the \x3cfield>.

Yes.

Tanks, aircraft carriers, skyscrapers. Things so big you start to have gravitational effects worth worrying about.

Q: Genetics?

Will happen more rapidly.

NNI dropped funding for MMT.

Q: Respirocyte MEMS version. Have things, small robots with technology we have now. FDA approval needed. Stick in animals now.

Bio, emerging nano. DNA to position carbon nanotubes at IBM.

Position 10 micron - 20 micron gold.

Proteins can become harder, like bone.

Ways to get it come to you.

Manuel: Cost of equipment to build a nano factory? Cost?

Good question. Depends on which approach is going to work out.

If we follow a particular path, it depends on what that path is.

Website: Nanofactory collaboration

/Nanofactory/

End of talk

Respirocyte

Net reaction:

C6H22O6 + 6O2 --> 6CO2 + 6H3O + energy

Two half reactions:

C6H22O6 + 6H3O --> 6CO2 + 24H+ + 24e-

24H+ + 24e- + 6O2 --> 12H3O + energy

\"But if we now imagine bodies to be projected in the directions of lines parallel to the horizon from greater heights, as of 5, 10, 100, 1000, or more miles, ... those bodies, according to their different velocity, and the different force of gravity in different heights, will describe arcs either concentric with the earth, or variously eccentric, and go on revolving through the heavens in those orbits just as the planets do in their orbits.\"

--Isaac Newton (1686)

Although several aspects of synaptic structure appear to change with experience, the most consistent potential substrate for memory storage during behavioral modification is an alteration in the number and/or pattern of synaptic connections.

The anatomy of a memory: convergence of results across a diversity of tests

William T. Greenough and Craig H. Bailey, Trends in Neuroscience, 1988, Vol. 11, No. 4, pages 142-147.

NT Session: Applications of Nanofactories

Merkle

Slides: http://bit.ly/cU9TXY

Videos at: http://bit.ly/dBceUV

=============== POST-presentation notes

Instant Evaluation:

/gsp10/feedback/week-4

/viewform?formkey=dGZadGpDejljY0JaWnRnV2Q1SEdYRGc6MQ

Ignite specifications:

/present/view?id=0AcWBCQSXI2ESZGNjbXN3M3RfMTNjcmpkNzhjbQ&hl=en

"

/core-Jul6-BB

"7/6/2010

Tuesday

2:30 pm

BB Session : Synthetic Bio & DIYbio Show and Tell

Speakers on this pad:

Eri Gentry

Slides: /leaf?id=0ByuGXnC_X6-QNGU2ZGM0NDgtOWIzMy00ZTI3LWI4ZjgtMWQxYzU3NmFiMjE1&hl=en

Audio: http://bit.ly/bkVWEx

Mac Cowell

Slides:

Audio: http://bit.ly/caLEN6

=============== PRE-presentation notes

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

New slide marker in Etherpad starting today:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

Suggestions for etherpad contributor signals during talks:

.

A period at the left margin means this contributor is taking a break

=

An equals sign at the left margin means this contributor is ready to capture the next words

(their first keystroke would be a backspace)

PRIOR NCS pads:

/core-Jun29-NCS-CL1

/core-Jun29-NCS-CL3

=============== End of PRE-presentation notes

DIY Bio

/

Biocurious

/

OpenPCR

/

Mac: DIYBio was founded in 2002.

Lot of people interested in biotechnology.

They hear you can program life, get really interested in that.

Huge, huge hockey stick.

Small group who have had training on DNA, using microscope.

Range of skills with second group.

Very small elite group - PhD in biology.Blurry boundary - making new things.

How do I build myself one of these pieces of equipment.

They are innovating.

Not to start biotech company in the traditional sense, but to help newly interested in biology folks.

Perfect storm, really easy and dangerous.

\"High School student brewing influenza in bathtub: Will he kill us all?\"

So, it has a lot of press. Sexy and easy to spin as being dangerous.

Two things:

Democratization is important.

Trick with vodka, soap, shot glass - can isolate theoretically, chemically with spit.

Do that right in front of them.

Half of people freak out \"there is DNA in there!\"

Culturally we have a disconnect.

Ivory tower of science and rest of society.

First thing, DIYbio will help change the culture.

Second, market for new kind of tools not aimed at science, but tinkering and play.

Tacit knowledge, not between lines of a protocol.

Fun. Not necessarily good at discovery, but good at play.

The way science is taught, there is no need for those tools.

But the new community demands it.

\"Lo-Fi\". Phrase - low cost, rough analog.

Versus really precise robots running around.

From safety/security - be open/transparent.

Six kinds:

Hard core biohackers

Entrepreneurs

Artists/

Educations

Journalists

Policy Makers

-

Capabilities:

94% talkers

Tiny percentage can innovate.

-

DIY Bio

People want to play

-

Why?

Science is not working so well culturally.

They are afraid of DNA.

Remove hype/elitist mentality.

Disruptive innovation - cheaper, easier to use, actually better than existing tools.

-

Freeman Dyson

So long as biotech is faceless, people will be uncomfortable with it.

-

W. Brian Arthur

The Nature of Technology

-

-

Why now?

Lab-as-a-Service

Lab will send you back copies of DNA

Synthetic Biology tools

Three kinds

life from scratch

mods

building from modules - ability to create complex systems gets cheaper

DIY equipment & techniques

help you play.

Like first blinky LED for electronics. Things don't exist for biology.

-

Conventional kit.

Biorad - E. Coli kit. $110

Only available to academics

-

DNA Explorer $80

-

bioweathermaps

Most meat different species than you thought it was

Swap, mail it back.

1,000 different species.

- culturing bioluminescent marine microbes

Microbes grow on squid.

Grow more yourself http://bit.ly/diybio-squid

- Rapid

- algae photobioreactor $50.

Triangular system and algae go from a few grams to filling the whole thing.

- Tito's Gel Box. $499

- $100 2-axis microscope

Hackteria [ref]

Amazed stupefaction.

Hack a webcam, turn it into a cheap microscope.

Made version with servos.

Went to tech shop - \"I'll just print it\" takes 5 hours (what you thought would take 10 min)

- slide with scotch tape

- worms

Tito: Here last week. You have a makerbot. That is a really powerful technology.

Same spirit that got me into biology.

Brown.

Biomedical engineering.

Artificial limbs and stuff.

Synthetic biology - detect lead in a water sample and then glow.

Something to think about.

Then I graduated.

Once I got out and got real job with Accenture and EBay.

couldn't do biotech.

Or something I want to print (an iPhone case)

Or cells that detect lead and glow,

so that's when I got started on DIY.

DNA - looking at it. Sushi restaurant - does fish you are given match menu.

Engineering DNA - glowing cells. Take what nature has or invent new stuff.

I wanted to do both.

Anyone do gel /wiki/Electrophoresis.

For pronunciation: /dictionary/electrophoresis

Pearl Gel Box

/

Fundamental part of your work if you want to look at or engineer DNA.

You can build it - I will demonstrate.

Device like this you can build yourself.

Mac: Thanks buddy.

Alright.

Other thing to show you real quick: microbial fuel cell (/www/). Just scoop up soil, put it into one of these guys, wait 5 days and it generates 5 microAmps of current. You can measure that.

Biggest is underwater.

Live cockroaches demo. Analog electronics. Neuroscience PhD.

SpikerBox $120 neuron recorder.

You can measure action potentials on cockroach leg.

Put a hair in a groove of a record - was able to listen to a song.

-

LavaAmp (/) different from other PCR- normally you keep liquid in a single place.

Quick show of OpenPCR (/)

Normal PCR machines cost, what, $3-10,000.

This will be a kit for $400.

Josh: Lot of biotech people here.

/wiki/PCR

For those who don't know, PCR copies/amplifies DNA. Useful for a lot of lab applications.

For many operations, narrow to DNA of interest. Clone it, whatever downstream applications are.

Will build about 1 billion times the DNA I started with.

I'll turn on this OpenPCR. 16 well.

Designed for hobbyists.

Based on Arduino. Has a heat sink in here. Peltier coding

Later won Nobel Prize for process.

Polymerases -

Cycle between 62 and 95 degrees C.

Each cycle doubles amount of DNA.

Lid - on higher end units, greatly simplifies process and makes it more reliable.

Mac: Sweet. Alright.

Eric: What is PCR?

Mac:

- what's happened?

Lots

- who invents

Where is it going.

I consider Arduino a toy.

Not the solution a professional would use.

You don't program it in assembly. Designed for non-experts.

Tinkering is what they wanted to enable.

Tinkering is what Arduino was designed to enable.

Until we have tinkering toys, it will be hard for people to get into it.

Because designed for amateurs, support tinkering implicitly.

Two paths:

refactor

invent something new

: Hand held potentialstat - drive electrochemical bio sensors. Like things diabetics use.

We use them to detect DNA or proteins.

Sarah Jane: I'm a collaborator and adjunct at the School of Anatomy & Human Biology, Uni of Western Australia home to SymbioticA: the Center for Excellence in Biological Arts. http://www.symbiotica.uwa.edu.au What has been the effect of the Steve Kurtz Critical Arts Ensemble Case? [/faq.html]

[Critical Art Ensemble: Performance and installation art collective exploring the intersections of art, technology, radical politics and critical theory. / ]

Mac: Caused fear and concern.

FBI had loaded gun. Bring terrorist to

Artist doing fungal work.

He spent 3years to get out.

A lot have been afraid and mis-trustful. Because of transparency.

Talk about capabilities, talk to FBI.

I was in Switzerland to talk about biosecurity and biosafety.

Interacting with authorities.

Convince them not much to worry about.

Sarah: What is the implication for Individuals?

Mac: That's where organizations come in.

Whole buying thing for biotech - prices require accounts, ask for quote, lots of rules.

Then rules say will only ship to academic institution or actual biotech company.

Ordering stuff to do PCR.

Carolina Biosciences - high school level kits.

1983 Patents expired. PCR is something you can do, you can sell, you can inspire other people to do.

For lavaAmp project, they patented their design. Overall, for legal resources, come together as groups. Have a forum.

Chiara: Don't you think things are kind of risky, need regulation?

Safety in biotech is structured around institutions.

There is no framework for individual besides \"NO\"

Chiara: Companies and universities have labs. If in safety environment, you don't spread things around. I'd be scared if you don't know what you are doing.

That's why getting together in space.

Sarah: CSI kits for children to play with. You can get that kit in children's toy store. Learn to become a forensic expert. But if an artist had the same science, they would be under suspicion.

Glass tubes or something else, all seen as dangerous.

If interested in getting involved.

Raising a couple $1000. Smoking. Smelling lie smoke.

If interested, go to OpenPCR/kickstarter.

biocurious staring up now. Trying /kickstarter.

3:23 [applause]

Come back at 3:30. (Big hand on the 6).

Biocurious by-line

\"Experiment with your friends\"

Coming up: two halves - Business plan development and hands on.

3:40 Tito: Whether you like brussel sprouts is determined by one letter of your DNA.

Put gel in gel box.

Put DNA on one end.

Put electrical charge through it.

DNA is moved through gel.

bigger pieces move slower.

So you get lines of DNA.

Really useful for working with DNA.

So, why buid this?

In every molecular biology lab out there.

Equip whole generation with capability.

Pretty basic.

Q: How long does it take?

About an hour.

Q: What charge.

DNA is negatively charged.

If you push it the wrong way it goes out the buffer.

Davidad: What does it tell you?

The length of the DNA and nothing else.

Eric?: Break the DNA at markers.

Chiara: That line is 300 base pairs.

The bitter tasting experiment.

Chemical that cuts at a particular sequence.

Everyone gets either one band or two smaller bands.

Ever made stuff? This was an interesting adventure for me.

It is a plastic box - very easy. But it's not.

Look at this. If ever glued together. Model car. You get glue on your thumb and put it on the windshield.

So I wanted to build a kit that people could build.

DNA is clear, tiny. So how do you visiualize it. That's where this blue light and orange plastic come in. You stain the DNA with a chemical that reacts to blue light.

The light turns on when you plug in the power.

So this is the kind of result you get from your experiment.

You might say this was 6 different samples.

Low cost.

Other labs use UV lights. Requires sunscreen, etc.

Blue lights are cheap and safe.

Q: White base?

So it doesn't hurt your eyes.

You need electrical current going across.

You don't actually need a lot.

You need a gelatin and DNA.

I've done it wtih a pan and gelatin from the store.

Something you can do in the kitchen.

Chiara: The electrodes go in between.

Mutagenesis - not completely safe.

You wear gloves when you do this stuff.

Connor: More current goes faster?

Yes, but resolution breaks down.

4:49

Eri Gentry, Founder, BioCurious: A hackerspace for biotech

\"Experiment with Friends\"

Granulocytes found in \"magic mouse\" found to not cause cancer - look for in humans, not sure where to find these sites yet.

This is my proof of concept for a garage startup.

VC can look at it and say, \"this is good enough to be funded\"

Hackers/makers.

-

John sitting in lab looking for cure for cancer.

-

Guido who slept on couch.

LavaLamp - Place sample in plastic tube.

Three heated chambers.

Make it reform and copy.

Basically doing that time after time to make bazillions of copies.

Cuts time.

So Guido is now in Colorado, won an unreasonable scholarship.

Great experience in Venezuela.

They had to grow and extract horseradish peroxidase.

/wiki/Horseradish_peroxidase

Meetups Biocurious

Hacker Dojo here in Mountain View is where I've made friends.

Typical answer is \"let's start a company\"

Might be a new way of doing business.

Crowd sourcing

Microfinance

Next meetup on July 17th.

biology is technology (book) [ref]

how in the next 50 years biology will be what computers were to the last 50.

-

Here I am tearing a leg off a cockroach. The legs grow back.

Tim was a PhD. He was frustrated that you had to be 23 and a PhD to do this kind of science.

Lower barriers to entry to biotech.

No excuses. If there is a problem and you know how to solve it, you can do it.

The closet lab of engineer, clothes, tools and the rest.

Diagnosed herself with /wiki/Hemochromatosis, a disease her father had.

- What happens when biotech gets in the hands of Makers?

People need problems to solve

They need resources

They need to get together to talk about this

- Webcam Microscope

Scaffo Garby - active in UK

- Pearl Biotech

- LavaAmp

- PCR

we'll talk about this in case study.

Going for financing.

More advanced way of doing PCR.

- Homemade incubator

You can raise chicks in it.

Bought off the web.

- Homemade Clean Bench

If you need a clean environment, would typically cost $12,000.

Function? To keep particles out of the air.

I have allergies. Same as a HEPA filter.

/wiki/HEPA

- Homemade Shaker

cost $45 to make, instead of an $8K

Do an instructables on it.

/

Didn't want to communicate what they were doing to the public.

Silicon Valley is such a cool environment. I've seen such cool hacks.

Not much limitation except resource and education.

Josh is completely self taught. Probably doesn't like me talking up here because he is humble.

At Biocurious, we're going to have classes. Community aware people who can talk together.

-

These are all examples of people I have met.

People doing quantified self.

I get this reaction so often - \"I'm not a scientist, you can stop the conversation.\"

Meeting the right kind of people who embrace knowledge and want to share it.

Hackerspace will be like that.

We are looking for $30K. So far about 20% of the way there.

Tim O'Reilly said he would tweet it. We had 400% more traffic and 30% more donations, and even more today.

VC versus crowd funding.

There are ways to manipulate crowd funding.

Now you don't have to rely on the old model of business.

Looking at how you don't have to change your business to meet their ideals.

People can get financial support and build a community.

That is a different world.

-

We'll do the case study - OpenPCR launched 6 weeks before us.

They've raised $10K.

-

Jason deals with this every day.

Leaders in policy, science and education.

Berkeley iHouse July 29-31.

-

The End

/kickstarter

Now the new type of lending platform

Kiva

Profit sharing.

You get a zero interest loan.

Has not only talked to people he is going to a profounder project.

OpenPCR as the example.

Who can use it?

Should it be open source?

S

openPCR Case Study:

This was the tool that enables a lot of what we want to do.

Purchased things that weren't working properly on eBay

For ~6 weeks, a number of componens on his desk. At that point, only personal funding. Wnated to expand so that other people could use it.

Started Kickstarter program for $6000 to create a kit for people to be able to create their own kits...

At first there wasn't a case for openPCR - similar to SpiderBox not being able to find a box. Talked to the people on this group and they gave them the idea to use a wooden box. Don't need to reinvent the wheel!

16 well plate

What is the market for openPCR?

$512 pledge upfront gives you a kit..

Schools - highschool students in Bay Area are beginning to use these!

Forensics Departments

Online Dating - like the dating site which match someone with people who don't have the genetic diseases you have an other cruder things like attitude

Nutritionist/Dieticians

Doctors

DNA-Sequencing companies like 23andMe

Personal genomics market (this is large in Israel)

Should this be open source? Can you have a business around this?

Being open source, people can hack it

Funding?

If the price is dropping by an order of magnitude, there are many groups who would definitely buy this as compared to more expensive alternatives.

Q: Is it possible to ship this to Argentina?

A: Maybe if you ship it as something else

Andrew's Comment on open sourcing: Linux model router could put your own firmware on it. Despite not having all the options, it was bought a lot because there were so many more uses for it because you could play.

Profounder is interesting new platform launching this year.

Should be promising in crowdsourcing.

Eri: To start off talking about OpenPCR. I'm super excited about this.

One of the fundamental pieces you need.

I want to learn how to program the Arduino.

That is very powerful information.

Do something that is biotech related.

I'm going to hand the mic over to Josh.

How he got here with Tito.

And their super successful kickstarter project.

Josh: This is a project that really should exist.

Tito and i had been working together about a year.

This is really the tool that enables a lot of the stuff we wanted to do.

Tito had a recycler for $400.

We decided to go forward.

6-8 weeks, I had components on my desk.

Getting it to cycle.

Getting it to cycle accurately.

Put money into product.

Make it easy for others to assemble too.

Took hours to assemble.

Make it into a kit.

Optimize components.

Remove unnecessary components.

Produt running now. Has about 20 days left.

Met all kinds of people who want to use this.

Benefit other than just financially.

Eri: I've seen the components spread out.

Seen it come togther and work.

Trouble finding a case as well.

They gave me some great websites.

Made out of wood, \"That's biotech?\" Yeah.

Always happens by chance.

Lot of reinvention of wheel.

Back to case study.

Tell me what the market for something like this is.

Their friends? $500 pledge gets you a PCR.

Versus $10,000.

Has 16 well plate. Functions along same timeline.

Who could you see needing one of these?

School - create biotech programs in Bay Area high schools

Many adults want to learn about it as well

Police Departments - forensics

On-line dating?

There is actually an on-line dating site that looks at HLA.

Nutrionists. Quantified self crowd. Diets for other people.

Doctors prescribing morphrin.

23andMe.

What about other countries? Maybe redesign for personalized medicine.

Huge in Israel.

Emiliano: If you bring price down by order of magnitude, interesting in rest of world.

Eri: You are from Argentina. PCR here - issue shipping it there?

E: Just ship it as something else. Not a PCR.

Andrew: Model of router that I used to buy because it was cheap, but friends and I bought about 20 because you could re-program it. Someone will figure out how to hook your PCR up to a toaster and figure out how to make that useful. Open source can drive interest for things that are just low price.

Eri: Open source conflicts with the way things being done.

Patent? No.

IP? Not really. Just want to put this into people's hands.

Take that to backer. Not going to get support like a typical internet company.

Rosa: How much do you want to make?

Eri: No business plan now.

May be people who just want to do things to make money.

Is it important for them to keep IP private, or still have something they can live off of?

For OpenPCR, I 'm using this as an example.

No plan for this to be a business.

They've used kickstarter.

They can afford to redesign this.

Power source is ginormous (large).

/dictionary/ginormous [Yes, this is a real word.]

Maybe you don't need a real business.

Emiliano: If you want investment, you need to have a real business.

Chiara: If you are a non-profit, you still need to make money somehow.

Kind of limits what you can do.

If you are innovator, do you want your life to be around this one thing.

Maybe this is part of the learning curve for you.

Strong arguement until crowd sourcing becomes available, you had to have investors.

People you've never met giving you $500.

I don't know yet.

Davidad: Meta-business. Open hardware ideas, and essentially a manufacturing business. If you invented this, you don't want to laser and ship things.

[see - /]

Eri: Please e-mail me. eri@

Sasha: If run as a break even business, what are service layers that can go on top of this thing. Use OpenPCR to do more things. Gets them to purchase your unit to do what they need to do.

Eri: Bringing your product to the open market, brings in people that you have never met. People who have worked on sailboats, done DNA analysis. Inspiring stories that have helped shape and inform.

I'd like to cover steps to bring to market:

Garage biotech - something you've made

What would you do to support this?

Would potentially quit your job if you could have -- what?

What are the real steps you would take to transition into a biohacking lifestyle?

Rosa: Find credible users.

Strongly depends on the user experience.

People who use this alot.

Spread the word.

Eri: Let your friends give you honest feedback.

After final design, several iterations, people are happy -- now what?

Andrew: What's it called when it is really successful but no one is behind it?

Exactly. Figure out how to produce a certain number at a certain scale.

Lot of inside-the-box lessons. Make it with the resources you have so you can continue to do the things you love.

Bryce: Stop calling it a hack.

/wiki/Hacker

\"

*Hacker (computer security) or cracker, who accesses a computer system by circumventing its security system

*Hacker (programmer subculture), who shares an anti-authoritarian approach to software development now associated with the free software movement

*Hacker (hobbyist), who makes innovative customizations or combinations of retail electronic and computer equipment\"

Eri: Hacker could be either dangerous -- or cool.

eri@

=====

DNA Dating Sites (warning: psuedo-scientific)

/

/

=============== DURING-presentation notes

Color card definitions:

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Link to backchan.nl for questions:

2:30pm\u20144:30pm Afternoon Session

http://singularity.backchan .nl/meetings/view/140

GSP10 Book List:

http://bit.ly/GSP10BookList

=============== POST-presentation notes

Instant Evaluation:

/viewform?formkey=dGVzY3JzR3VFeTJjSElVcjM3REFpY0E6MQ

"

/core-Jul6-NCS

"7/6/2010

Tuesday

9:00

NCS CL4 Theories and practice of Quantum Computing

Geordie Rose

Speakers on this pad:

Geordie Rose

Slides: /leaf?id=0B6vjqTaW5opaMzFjMjkwN2UtODllNy00NzE2LWIwNGItOGVjYjNjYTdkMDYw&sort=name&layout=list&pid=0B2Ij9HPeinaFODJjNjVlYTItNTlhMC00YzI0LWFlZDEtM2U3NTg3ODc5OTNj

Ted Selker

Slides:/leaf?id=0B6vjqTaW5opaOGY5ODE5OTQtYzE1Zi00YzIzLWFiNjMtYzE2ZDgxMWZkZTU3&sort=name&layout=list&pid=0B2Ij9HPeinaFODJjNjVlYTItNTlhMC00YzI0LWFlZDEtM2U3NTg3ODc5OTNj&cindex=8

Andrew Minor - Nanomaterials

Slides:/fileview?id=0B6vjqTaW5opaOTBiYzEzNjQtMDVkMS00Y2E5LTljODctN2FhMDE1YTBhOGQx&hl=en/fileview?id=0B6vjqTaW5opaOTBiYzEzNjQtMDVkMS00Y2E5LTljODctN2FhMDE1YTBhOGQx&hl=es

=============== PRE-presentation notes

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

New slide marker in Etherpad starting today:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

Suggestions for etherpad contributor signals during talks:

.

A period at the left margin means this contributor is taking a break

=

An equals sign at the left margin means this contributor is ready to capture the next words

(their first keystroke would be a backspace)

PRIOR NCS pads:

/core-Jun29-NCS-CL1

/core-Jun29-NCS-CL3

Geordie Rose

/

D-Wave systems are architected around an innovative processor that uses a computational model known as adiabatic quantum computing (AQC).

/wiki/Adiabatic_circuit

/wiki/Reversible_computing

\"Adiabatic Logic is the term given to low-power electronic circuits that implement

reversible logic. The termcomes fromthe fact that an adiabatic process is

one in which the total heat or energy in the system remains constant.\"

http://www.cs.caltech.edu/cbsss/finalreport/nanoscale_ind_gojman.pdf

Asynchronous Logic Automata

by David Allen Dalrymple

/Dalrymple-Thesis.pdf

\"In addition, this model adapts much more easily to take advantage of adiabatic logic

design. For instance, when a cell is being used only to ferry tokens from one place

to another (e.g. an inverter, shown in Fig. 2-5), it can do so physically, instead of using

a traditional, charge-dumping CMOS stage.\" (pg 30)

=============== End of PRE-presentation notes

NCS CL4 Theories and practice of Quantum Computing

Gordie Rose

9:08

Brad: Geordie's company is looking to commercially exploit quantum computing, with DWAVE.

Geordie: Have raised about $100 m and spent 10 years. Things are going to work.

Recurring theme.

\"Solving Hard Problems\"

- Quantum Computing Hardware

Eyes opened by research

At startup, you get focused on a small world.

At my world we use a substrate called a superconductor, using metal called Niobium

Kind of lost track of what else was happening in the world.

three important thingsShould be able to build large scale quantum computers with these approaches

- Today

You are likely to be extremely entrepreneurial.

two parts of today's talk:

1.hard problems vs standard approaches

2. quantum computing

-

So we often talk of \"not hard\" problems.

Anything you can do with your laptop is not a hard problem.

There are a lot of things you cannot do with your laptop.

- Humans are good problem solvers

Carl Sagan on YouTube makes you feel good to be human

- All living things

We have not given respect to the world around us.

Lots of things are good problem solvers.

Not typically \"intelligence\" but hard problems:

plants solved problem of turning solar power to energy over millions of years

Even though things don't seem intelligent the way we are,

even ants do things.

-

Every thing in the universe is solving a hard computational problem just by existing.

Science = figuring out what problems things are solving

They solve the laws of physics.

The Apple is solving Newton's equations when it falls.

Rock, just sitting there, is doing exceptional things way beyond any computer we have ever built.

Nature is very mysterious still.

The way we look through science, even dust is doing immense amounts of computation.

-

What we know for sure is that if the ways we look at science are correct even a piece of dust is doing an enourmous amount of computation

-

Horizontal technologies. Computers can underlie a vast number of things.

Can't simulate physics of that rock.

-

Another Moore's Law out there - Jaguar http://www.nccs.gov/jaguar/

Folding at home [ref] This distributed thing is much faster

10 petaflops (1petaflop=10^15 floating point operations/second)

Kicks major ass!

-

Who cares if it is the size of a basketball court.

Better to think about how much power it takes

A light bulb is 100 watts. The way supercomputing is going, people want to build a system with 1000 Jaguars.

Energy use goes way up.

-

Zero processor innovation going on in high end computing.

All the proessors are available at the local store.

-

Richard Dawkins: The Ancestor's Tale

-

Processors are all one species. Cheapest, dirtiest cell phone to highest end ... all the same.

Under the hood, it is all silicon, junctions, same architecture.

- tsmc

Lack of biodiversity is an issue.

Where are chips going to come from?

No choice.

Why?

Complicated - FAB (fabrication)

TSMC - Taiwan Semiconductor Manufacturing Corporation - /english/default.htm

If you can build the things you are designing, you are set.

If you can't, you won't go anywhere.

-

http:

-

Problem I'm going to raise with this:

boat load of chips, maybe an Exoflop ... but not right tools for the job

Quote from guy who runs Jaguar.

-

Imagine you are a lady bug wandering on integrated chip. Very little you could imagine of what that thing does -- even though you are right next to it.

-

We encounter things that we are completely unequipped to deal with.

Bottom line, dirty little secret: we really have no idea what is going on under the hood.

We have no conception of something as simple as time.

Giant machines - types of problems they solve are things we understand:

predicting weather

nuclear fusion

-

What I'm going to do now is argue for a new approach to computing.

We're going to try to be the ladybug.

Absolutely clear that the wonder and machine around us is beyond our brains.

To think otherwise is just ridiculous.

-

If you want to do something computationally, how long does that take?

Brain simulation.

So often when this discussion is raised, something like this will come up

-

How long something takes is only one part.

Run time = number of operations required/number of operations per second

Number of operations per second is the part we change

NOPS is a hardware thing.

No mention of software

Only indirect measure

-

How to make computing things more efficient

Prescriptions for solving problems.

How to get to NASA Ames, rent car

-

Why - central point - use example of factoring.

Factoring

Two prime numbers

Take product

Back in 1977, Scientific American, said, find which 2 numbers multiply to give number.

Someone did it in 8 months.

-

A better way to factor numbers was found.

In 1994, discovery of quadratic sieve. Do many, many less operations.

Old algorithm was drive to LA, then Palo Alto ...

New, skip trip to LA.

Interesting exercise. If you had best 1994 hardware with 1977 software VS 1977 hardware wtih 1994 software- old hardware wins with new software.

- What's a Quantum computer? - it changes the numerator in the runtime formula, changes the number of operations required rather than the number of operations per second. The focus is shifted from the speed of the processor to the algorithm needed to solve the problem.

Analog would be - someone finds Quad Sieve. Imagine you needed a Blue computer to run it.

Special type of computer can run these algorithms, but not on any currently available chips.

We have yet to be able to build a computer to run them.

-

What's a quantum algortihm - A prescription for solving a problem, where at least one step is impossible classically but possible using quantam mechanics

Something that can run quantum algorithm.

At least one step requires a quantum. Superposition required.

About 40 good ones, can send a link.

-

- Factoring: Shor

10^40 is giant. Vast reduction in number of operations.

If we wanted a quantum computer to factor numbers, $100 m and 10 years.

Exoflops, about 10 more years.

Quantum computers not at all like CMOS [ref]

They will run on wall plug power, regardless of scale.

Quan Computer can be much lower, 100 mHz clock rate.

But number of operations is staggeringly lower.

I think factoring is limited, not a social good.

Factoring is one of many.

You take a problem that you fundamentally can't crack

Separation proofs. Simply cannot do better than a quantum computer.

- It's really not rocket science

When you read popular science articles about quant comp, it sounds hard.

It's not.

Building large scale quant computer no harder than building a car.

Is it worth the investment?

Entrepreneurs have generally answered no. But they don't understand the return.

Human mind is not capable of totally comprehending what is going on any more.

- Good signs

Believe me or not.

Two key inflection points:

1. When doing something useful - point has been past. Best \"car detector\" every built.

Very interesting thing.

2. Someone buys one

If you are going to do this exponential thing, you need money. Money is the fuel.

Real money comes from selling things, not investment.

Once people talk about government buying computers.

This field is going to take off.

- Messages to take away

People think they have solved the world's problems. Then one thread comes loose.

Reasons why we should stop whacking each other over the head with sticks.

Next press release about wonderful science bringing quant computing closer.

Like go cart speed up when you are trying to get to moon.

What is needed is 10 years and $100 m.

Ion traps most likely to succeed.

Why me? Somebody needs to take the plunge.

People in this audience could pull this off.

Highly recommend that you try.

9:43 [applause]

Brad: Some say it won't work. Why are they wrong.

G: Always will find naysayers.

Bulk of distribution - unsolved problems. That is consensus.

Brad: But what is their reason? Meaningful number of qubits.

G: Decoherence.

Superconducting Technology Assessment, National Security Agency Office of Corporate Assessments, 2005 (4 MB pdf)

\"GOVERNMENT INVESTMENT CRUCIAL

There is no foreseeable commercial demand for SC digital technology products sufficient to justify significant private industry investment in developing that technology. For this reason, government funding is crucial to this technology\u2019s development. Besides its use to NSA, SC will likely have applications for other government missions as well. Once it has been sufficiently developed, SC may also prove to have commercial applications.\"

http://www.nitrd.gov/pubs/nsa/sta.pdf

Erez: Money.

G: Matter of where to spend it.

Building high performance computers has momentum.

Really a matter of resource allocation. Exo-scale or something you don't understand.

About number of qubits - bottlenecks are about processor architectures.

You could build one with 1000 qubits if you could build one with 5.

People know how to do the architecture things, but not the quantum computing things.

Very much at scale of lab experiments.

You need 20 engineers with 20 years of computing experience.

Solving discrete optimization problems. Sets of coupled binary numbers.

Find optimal setting of switches. Very hard.

Applied most fruitfully in machine learning.

The field where you teach the machine by example.

Cast learning as optimization, solve it on our chip.

From my perspective, short term win is machine learning.

Running \"bedrock\" [?] and those kinds of things.

Q:

G:We can run, get answers. That's not enough.

\"Yeah, but it might just be a classical thing.

a. need to build tests to prove the computer is working quantumly

b. people need to accept the tests

It is really about what happens when you build bigger systems.

QM allows you to do what classical computer can do but not vice versa.

Remark (Carlos): \"QM allows you to do what classical computer can do but not vice versa\" - As far as I know, this is not accurate at all. Actually, one can simulate QM and therefore Quantum Computation in a classical computer. The problem is that, in order to do this, one would need to keep track of an exponential number of complex numbers on the

number of qubits one is trying to simulate. So, it would be more accurate to say that the cost of simulating a quantum system using classical computation is prohibitively/exponentially high and, thus, unfeasible.

Remark (Erez):

I contacted Shai Machnes of the class of GSP-9. He is an Israeli physicist that specialize in Quantum Computing. Asking if the estimation for having QC in 10yr+100M$ is valid here is his response:

*A few thousands qubits - enough to simulate interesting quantum and solid-state physics - that sounds about right

*Hundred of thousands of qubits, enough to break codes - probably $1+B and 15 years

The Quantum community in general has a lot of problems with D-wave (The talker's approach. E.L.), their approach and their device.

It is actually not clear that their device does quantum computation. Not as far as I know.

At least I have not seen the papers and result to prove it (maybe I'm out of the loop, but I don't think so).

Using other techniques (linear ion traps), the current state-of-the-art is 14 qubits by the group of Rainer Blatt.

I think is most relevant is this \"Experimental Investigation of an Eight Qubit Unit Cell in a Superconducting Optimization Processor\"

Bottom line: a claim of a working 128 qubit device is unsubstantiated (and never made) by their scientific publications. I therefore conclude it is PR, wishful thinking (or they have made a huge huge breakthrough which is not reflected even in their publications of 2010 - but that is highly highly unlikely).

Simulated annealing (SA) is a generic probabilistic metaheuristic for the global optimization problem of applied mathematics, namely locating a good approximation to the global optimum of a given function in a large search space.

/wiki/Simulated_annealing

10:08 Brad: Break til 10:15

NCS CL5 Innovative Computer Interactions and Interfaces (Ted Selker) Tue, July 6, 10:15am \u2013 11:15am

10:18 Brad: Next speaker, Ted Selker at CMU NASA Ames campus.

Stanford

Ted also at MIT Media Lab - context aware computing group. Nubbin on Thinkpad.

Once we get exoflop - how will we interact with them.

Short of implanting them into our bodies.

10:20 Ted: Noticed a lot of people enjoying their computers.

Attractiveness of machines, taking us out of the moment is not what we want.

Want to be in the experience of the moment.

We made 30x improvement with vector optimization to show how things were \"thrashing\"

Been doing HCI - dwith vector optimization to show how things were \"thrashing\"

Been doing HCI - decided to help people.

- HCI (Human/Computer Interaction)

What is HCI?

Chip in iron can tell difference between child's and adult's hand.

Advisory things. Teach a person to fish, they can fish all the time.

ABS brakes in car don't help you to brake better - you make lots of mistakes.

I don't believe there is anything people do that isn't spiritual, by the way.

All the machines we make. We make them sleek. Button that does what you want.

We want control.

-

What is the field.

Techniques of direct maniupulation.

steering

multidimensional - car is an amazing interface. Phones.

Voice - 97% effective or 25% effective. IF it goes wrong, how wrong do things go.

\"Speech\" or \"Beach\"

Without context we are very bad at understanding language.

Ambiguity allows us to fit what people are saying into our way of thinking.

Missing in today's voice rec.

Things like voice reco, is a technique.

Technology is when it works.

output: screen, text - language of things people expect to see.

\"Room with a view\" World out the window, phone book, ... this was a GUI.

Select things with these viewboards.

Dan Rather said, \"I can't imagine anyone living there. So futuristic.\"

Your opter[?] where you focus when you are reading.

Physical output. Robots have been coming forever.

I went to Panasonic.

I designed the ThinkPad.

\"We can't put that thing in there because we have robots.\"

Went there and found they used jigs.

Kind of mistakes - brittling - and furthermore robot was a complicated device for the work flow. Understand why we want flexibility and programmability.

Weeeeeeee. Woooooo. Pck.???

Complexity

Today's models of what to do.

You go up to door, door opens.

old ones were better.

Now they have a people sensor.

The model of leaving the grocery store is broken.

If person is standing there, they may not be leaving the building.

I love using a sensor for all it can do.

I want everyone to think about scenarios.

See why to give you the $100,000.

\"Well we;re so brilliant and wahtever\"

When I studied for performance and preference was found instead of performance, I didi not phraser the question right

Press got in smart car and press got in and \"blinker please\" was sounded when they left the car without using the blinker

Realized that interface shouldn't nag you and make you feel bad except maybe just to announce it's there at first

My problem is you can't base everything on looking in your rearview mirror.

You want to try the future not the past.

How do I know if that is good.

We have to find ways to get people to try it.

I'm known for making this pointy device used in every space flight.

I read a book - Stu Carden 1993 HCI - takes 1 and 3/4 seconds to move to mouse.

Better to put in the middle of the keyboard.

When you make a rate control device - rate control has too much gain. People overshoot.

A lot of what we did was watching while people used it for \"racecar runs\" - selecting icon after icon after icon.

In graphical interface, version \"awful and ugly\" but 30% faster.

Different sizes

semantically grouped

Identifiable icons - irregular placement

All of those things helped memory.

First 3D which improved over 2D performance.

If gray - see through interface was new.

Graphical interface took delicacy.

Memory loads.

Cell phones are just becoming amazing.

Course on Android product dev.

No one had touched it.

Sensor pack that robot makers would love:

Gyro

Compass

camera

In one click - download Eclipse.

Get UI libraries

and drivers

Program to get to sensors.

17 apps from 21 students. 5 products.

User Interface of the past was trying to get one sensor to work.

Today, it is context.

Shiny knobs and buttons don't impress anymore.

We have to understand, now that we have the finish, what to use the finish for.

Scenarios are exciting.

Happy to talk to you about how I can be helpful.

I care about environment, energy, ...

Lot of new scenarios we can create because people care about being together and interacting with each other.

Ref: http://www.cylab.cmu.edu/mobility/

-

Here is a cigarette I made.

you are the dating game.

Basicaly, helps you take a break.

It would be unhappy in your pocket.

Touch another one and it would be happy.

Give yourself rewards. All things cigarettes have done.

We use technology for defining who we are and how others see us.

\"Understanding Considerate Systems\"

-

People expect system to be deferent.

We expect machines to act in a social way.

They will.

Today, they don't.

They might know where they are, but not how to interact with people.

\"Context Aware Computing Group\"

What I did is I made dozens of demos:

computers in beds, kitchens, bicycles

AI is learning, representationand reasoning.

Use those elements to make better interfaces.

-

Made car you have to pedal.

6 m people who will have 5x more accidents than you.

If they pedal while they drive, they don't fall asleep.

Postal truck that did neat things.

-

Intention

We want to understand people's intention.

That's what sensor are for.

Butterflies on the floor. Would paint a podium. Social commentary.

Would take you from demo to demo.

Would not use audio - pretty important for people to be able to dominate.

-

Had a chance to work with people with Alzheimers on [ref]

Give them pictures of their life. More connedtions with more people.

Most successful was puzzle.

If you do nothing, puzzle is also solving itself.

It is just guiding you and it has a celebration.

An art historian is typically not an artist. What if we could take critical posture and turning it into creative posture. Kaliedoscope - hit the keyboard when they didn't like it.

-

A door.

What is that moment of choice when I go onto and off podium.

Organizational model. Everyone treated differently.

Task model. Let someone disturb someone who is working - a reasoning, not learning system.

-

Diane Sawyer asking about interaction.

Photo diode checking whether

staring intently

blinking

just looking around

-

Can run parties where people's intentions were recovered by these cameras.

That is techniques to technologies.

Eyes - try to see where looking - actually HOW they are looking.

Look at things for social reasons.

That overlay what you expect, with function.

I could take anyone walking into my lab and have them competently doing things.

I'm always looking for maxium implicit communication.

Good user interface is taking the toll out of the task

- Learning by Watching

- Invision

Group things by your interest.

- LaughCam

Support Vector Machine to classify what the sounds out of her mouth meant.

What she said was reliable indicator of what she was interested in.

- AI Can Help

To make things make sense to a person.

Coloring done by machine learning system, only 65% correct.

Even if 35% wrong, people are good enough to not notice that distraction.

The \"ransom note\" interface.

Better than interface that is completely consistent.

Folders?

You went back to Gmail.

- Car Coach

A variable schedule of reinforcement is productive.

If we say anything much negative, we do worse.

When you do something right - tell them right then? No. Give them a second to a second and a half. it is a much better time.

Connor here? He helped build a 14 display Pepsi machine.

Interesting for what it did. How many people in front of it. Design a game.

- IM Disruption Manager

People distracted. Certainly we are.

People at Microsoft. How to make interruption consequences reduced.

Able to get 30% more forms filled out.

Be more careful - 25% fewer errors.

Act of changing how disruptive things were coming in. Bring them - only 2 minute delay - when you weren't as active.

-

Talking trivet. Cooking.

Box knows how long in fridge

-

Dice that teach about patterns.

counting

probability

Playing with considerate interface.

- Smart sink

- Spoon that teaches cooking

What would it take for people to like their spoon?

teach them to make things like candy or chocolate

- Digital Cig

-

In 90's wearable computers.

I think I want to be in the environment.

Great helmet - mediate between myself in the world.

Wore for 8-9 years.

-

-

Smart kitchen.

Overlay information on surfaces.

Projector - smart light - great fun if it doesn't frustrate you.

Words on wall didn't help, but flames around burner.

Painting on the world.

How you say things matters.

HCI books:

Card & Moran

ACM CHI

Interact

IUI

What do you got to know about? Cognitive Science.

What are our abilities?

Statistics. If you don't have it, you are not doing HCI.

Design: crucial to creating scenarios.

Computer science.

-

Androids example - people making dumbed down interfaces.

Tools you can download in one click

Know variables

Barely had with supercomputers

These kids in one week were up and running.

I tease myself.

Art is having ideas that will create emotion

Science is ideas people will refer to

Design people will use.

Designers have not written. How important emotion is.

Thing really missing is the evaluation part.

-

Leave you with something about what I do.

I love to create, invent.

Process of better user interfaces

is one of thinking of ideas as an action movie.

On a limb, snake, cliff, waterfall.

People are solving problems with the momentum of physics.

If waiting for \"the\" good idea, you won't be having good ideas.

We have been using computers for planning, now much more communication.

Many ways in which we engage with the world.

11:06

Ted: about 40% doing e-mail

Sasha/Canada: Challenge we face in development of websites, content dissemination things. We run into ability of people to understand. I'm just wondering how computers adapt to humans. How can we learn faster

Ted: Adaptive help system. First AI-based system. Watched while you programmed.

Matched help to you level.

When person doesn't know - give them a success.

Taking person from where they are to where they can go is the most exciting of all.

[holding sharpie]

This is a ball.

It has a squeaky part [the cap]

Learning these affordances is hard.

Sasha:

Ted: Epigenetic stuff. We can learn to learn better. We have tools. Memory aids are a big one. Pacing aids. Closed rooms where you can concentrate - that's a bigger one.

AI to help you forward through a path someone else has been on.

If you don't know what has been done before, lot of repeating things.

Alison Lewis/US: Thank you. I share your passion of lover of techology, express our emotions and stay connected. Struggle - consumption - being wasteful. Decided not be a project designer - adding more junk to the world.

Ted: This morning I took shower. Bucket. Took soapy water to flush the toilet.

In making processes, we don't have to make them consumptive.

In Japan, they have a sink hand wash that is the top of the toilet.

We can make things more/less consumptive. That is our choice.

Making products is inevitable. We can make them respectful.

Jan/Germany: So we are designing for Space, developing countries. Space? Trapped in our bubbles here. Developing countries- low tech.

Ted: Robots great in space. We do great in this bubble (Earth).

Developing countries - wells with diesel engines - people die when engine breaks.

Grocery stores sell stoves which use 1/5 of charcoal.

Jan: Tech deployed in 10 years. Way to leap ahead?

Ted: I love to think about the future. Things move slower - and faster.

Bathtub story. My water bill is twice my electric bill.

So it is an interesting statement - Water - big resource problem.

Human Reproduction - big problem

OLTP - a man-year's labor in a kid's hands. Mugged for a laptop.

In 10 years, not that long from now.

Bil/US: Enjoyed you talk. Very interested in HCI space.

Sensors.

Ted:I've got a story.

We sat around fire.Want to go behind bush.

Nesters and nomads as animals.

Hearth keeps getting bigger and room to get away from it too.

We do both.

Part of human spirit.

People will abuse each other.

Good things wil happen too.

Brad: CMU talk series

Eliz Churchhill - ethnographer with Yahoo at 1:30

Brad: Always great.

Ted will come by at supper time.

Alison: Android workshop.

Ted: Let's do it.

Brad: Portal where.

Ted: Room 118, building 23. Come in turn right. Every day, video taped. On website.

Open to public.

11:19 [applause]

Merkle: Next speaker. Andrew Minor. UC Berkeley.

Teaches the course on nanomaterials.

NT CL3 Nanomaterials (Andrew Minor)

WhenTue, July 6, 11:30am \u2013 12:30pm

11:21 Thanks for having me.

Nanomaterials. Ralph gave you an intro.

If something is not clear, stop me.

Take perspective of material scientist.

Lab in Hurst library building -steel was studied.

Silicon

Now diversified widely - biomaterials

Nano materials - what they are and how properties change with size.

-

Materials science -

Performance

Properties

Structure

Processing

all intertwined.

What makes a material a nanomaterial.The size.

Some characteristic length of 10s to 100s of atoms.

Laws of physics don't change.

course on quantum effects teaches you they roll up into newtonian physics.

Broad/easy definition - nano materials exhibit size effects.

nanomaterials exibit size effects

\"size effects\" when the size of the material affects the properties

-

Key thing about being small

More surface area.

As you get smaller and smaller in your grain size, the percent at the volume increases and this makes the properties change.

- Example of a size effect is melting point

If you have a particle very small, melting point may be at room temperature

(See Buffat and Borel, Phys Rev A, 1976)

\"property changes the size\"

- Thin Films- nanomaterials common in technological applications

Sizes have real life implecations. Parts in electronic circuits are already nano-materials. They are thin film.

- Real industrial consequences of size effects

Traditional microchip in processors is a MOSFET,

metal\u2013oxide\u2013semiconductor field-effect transistor

/wiki/MOSFET

usually the way they make things is they make things smaller. But what actually physically stop you to keep scaling things? When you get smaller and smaller, the properties change and thus different materials need to be used.

By the time you get down to 5 atoms of something, is it really the same as the origional material.

(See Muller. D. A., et al., Nature. 1999)

- Strength of Materials

Size is important.

Young's Modulus - Slope of elastic loading (GPa)

/wiki/Young's_modulus

Single-walled carbon nanotube[13]1,000+145,000,000+

Yield Stress - Actual Stress at which something breaks (MPa)

Pascal is a unit of stress and this is stress over an area.

/wiki/Pascal_(unit)

/wiki/Tensile_strength

DISLOCATIONS:

/wiki/Dislocation

- Most useful solids are crystalline

- Dislocations are missing rows of atoms which allow materials to deform mechanically w/out breaking.

- Explains why metals are ductile

Crystal is actually not crystalline, its amorphous

Dislocations are key to making metals ductile/brittle

- Early studies of size effects

First person to see size effects is Leonardo Da Vinci:

He took a very simple experiment, took an iron water and put a weight at the bottom to see how long the wire could be before it broke.

Half piece would break at half the weight as the long piece. The longer the wire the smaller the possibility of fatal flaw.

- Early tests on size effects (cont.)

Really small wires you can bend forever and they don't break.

- Ideal strength - the stress required to plastically deform a \"perfect\" (defect-free) infinite crystal = G/2pi

-Experimental strength = G/1000

- What happens when you don't have any dislocations?

Any material (except semiconductor silicon) has many dislocations in it

[ref Tensile Strength of Whiskers]

- Grain Boundaries

/wiki/Grain_boundary

Imagine you have a cube of water in an ice tray, you can have the possibility for:

1) one grain boundary -> solidification starts at one place (same way as metals solidify)

2) 2+ grain boundaries -> solidification starts at multiple places

These grain boundaries are important for how a material acts

- Grain Boundaries and mechanical properties

yield strength ~ grain size ^ (-0.5), totally imperical no one knows why

-Metallurgical Techniques Borrowed from History-folding techniques to decrease grain size

Japanese sword making - folding the metal over and over and over and the grain size decreases

/wgbh/nova/samurai/vinci.html

-Accumulated roll-bonding

Properties change on grain size effect.

Stress vs Strain Diagram: larger grains break at lower stress, but are more ductile

- Focused Ion Beam Micromachining

/wiki/Focused_ion_beam

\"Because of the sputtering capability, the FIB is used as a micro-machining tool, to modify or machine materials at the micro- and nanoscale. FIB micro machining has become a broad field of its own, but nano machining with FIB is a field that still needs developing. The common smallest beam size is 2.5-6 nm.\"

What's making materials smaller solely based on their size?

In Oregon Focused Ion Beam created

Ion Beam is like a sandblaster using ions. You can cut anything you want down to 7nm resolution. Semiconductor industry originally used this for mask repairing.

One of the inventors of this machine said that years after he'd been selling this to Intel for $1M a piece, they told him each machine they bought saved them $1M a day. That's how useful these were for editing masks.

But we can also use these for making little structures to test.

- Micropillar compression testing

Mike Uchic takes one material and just mills out different size pillars.

Same material, just different sizes, and then plots out the macroscopic yield strength.

From about 40 microns and up, you're going to find the same number every time- the number you'd find in wikipedia.

Log-log plot: double exponential strength increase as size goes down

People have done this for lots of different materials.

- Pillars - smaller is stronger

Copper, vanadium, magnesium, nickel - doesn't matter. Below 40 microns you get this hardening effect, purely based on size.

- Sample size vs defect density

Imagine a bulk sample of metal. There are lots and lots of defects (represented by T structures). If you start to pull or push this material, somehwere in the material a defect will move a couple atoms one way, and the material will start to deform. The bulk strength is where somewhere, one of those defects gives way. Now we make it smaller, so there are fewer defects. OK. Now we make it so much smaller that it's smaller than the characteristic length of the defect. Now it's a statistical thing - is there a defect anywhere in the material? If not, you have to create a defect to deform the material.

- In situ TEM mechanical probing at NCEM

/wiki/Transmission_electron_microscopy

\"Transmission electron microscopy (TEM) is a microscopy technique whereby a beam ofelectrons is transmitted through an ultra thin specimen, interacting with the specimen as it passes through.\"

National Center for Electron Microscopy

http://ncem.lbl.gov/

- Microscopes

What's an electron microscope? It's very similar to a light microscope - in fact, optically, it's almost exactly equivalent. The reason it's useful is that a light microscope stops being useful at about a micron. Because the wavelength of light we see is about a micron, and you run into the Rayleigh limit. Electrons, though, their wavelength depends on the voltage of the electrons, and you can adjust that voltage and see all the way down to individual atoms.

- Electron Microscopes

You have a very sharp tip - tungsten usually - down to a few atoms, and you get a very high voltage, few hundred thousand volts, and it pulls off an electron that shoots down.

- Electron Optical Characterization: key tool for nanomaterials research

You can do things with electrons simultaneously that you can't do with light. You can do spectroscopy - distinguish carbon from nitrogen - you can image, and you can do diffraction and see the crystal structure. But in the end, the most important thing about electron microscopy is that you get spatial resolution down to 50 picometers.

- In situ mechanical testing

You have to put the whole laboratory inside a very small space, keep a vacuum, etc....why bother?

You want to figure out why something's deforming. Video showed of aluminium deforning.

[movie of aluminum being dented by diamond]

Grain boundaries can move at small scale.

Another reason to do something inside an electron microscope is to test something that's so small, you can't find it afterwards.

- In situ mechanical testing (2)

Cadmium[?] compression - another deformation video. Being able to monitor your test is really important, because something might have just slipped away instead of breaking. That's why we do it inside a microscope.

This is 100 nm - very small scale.

Being able to monitor your testing at a small scale is important.

- Cu nanocompression overview

/wiki/Copper

This is a red blood cell, about the right size scale. We are basically doing tests at size scales that are within a cell. We're getting quanitiative information while also being able to see what's inside the test.

- Cu [100] Results

We're getting smaller, smaller and smaller. . . and we're running out of available dislocation sources (???)

- Cu [100] Single slip

The key is that you only have one type of dislocation.

Multiple slip and barreling.

- Mo pillar comparison w/ and w/o anneal

/wiki/Molybdenum

[movie of shear]

You do this at a stress of 16 GPa.

gigapascal (GPa)

The ideal strength of the material. The material liquifies. Instataneous liquification across the plain.

- Understanding Mechanical Size Effects

Computational Modeling - (See Gouldstone, Acta Mat, 2007)

- Conclusion

12:01 [applause]

Merkle: small things stronger.

Large things without defect, stronger.

Large things built from many many small things should also approach theoretical limit.

Q: Tony: Recycling?

Lead free solder

/wiki/Solder

Types of steels

Brad: Defects are place where there could be failure. Why not all edges?

Edge is very easy place to start defects. Also place get dislocation to zip right out.

Atypical hardening.

12:09 Applause.

Salim: Andrew will stick around.

Lunch. Soccer on screen.

Bio tech workshop this afternoon.

Questions about life tonight. 7:30 - will be wine.

Thanks for the day this morning.

Please take cans/wrappers with you as you leave the room.

=============== DURING-presentation notes

Color card definitions:

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Link to backchan.nl for questions:

9:00am\u201410:00am Morning Session I

http://singularity.backchan.nl/meetings/view/137

10:15am\u201411:15am Morning Session II

http://singularity.backchan.nl/meetings/view/138

11:30am\u201412:30pmMorning Session III

http://singularity.backchan.nl/meetings/view/139

GSP10 Book List:

http://bit.ly/GSP10BookList

=============== POST-presentation notes

Instant Evaluation:

/viewform?formkey=dGVzY3JzR3VFeTJjSElVcjM3REFpY0E6MQ

"

/core-Jul7-BB

"Wednesday

7/7/2010

9am - 12pm

BB CL3 Brainstorm Research Foundation (Linda Avey)

Slides: NA

BB CL4 Evolution of Directed Evolution (Lori Giver)

Slides: http://bit.ly/cH5aRj

NT CL4 DNA Origami (Paul Rothemund)

Slides: /leaf?id=0B6vjqTaW5opaYjBkM2I3YTktZmVhYy00MjExLTg1MTAtMTExY2IwYmI2YjEy&sort=name&layout=list&pid=0B2Ij9HPeinaFOTU0MDYzNDUtOWYzMS00MWI5LTlhNmYtYzc5MWU2Y2YzYjM5&cindex=4

=============== PRE-presentation notes

Goal for today: MASSIVE links.

Talking with Ted Selker at dinner yesterday, he suggested

5 links PER SLIDE. If we all pitch in on this, we can create

a very rich resource document.

Suggestions for types of links:

Key people

Companies/Organizations

Definitions of terms

Academic references

Software/Tools

Humor

Visualizations

Porn

More humor

If you don't want to interrupt the flow of the notes, use this parallel pad for links:

/core-Jul7-BB-links

Erez has introduced a new SUMMARY Etherpad:

/Pad-One-Liner

Please contribute.

Slide marker in Etherpad:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

[ref]

If you need a reference, use this marker.

PRIOR BB pads:

/core-Jun30-BB Seth Michelson, Raymond McCauley

/core-Jul6-BB Synthetic Bio & DIYbio Show and Tell

PRIOR NT pads:

/core-Jul2-NT Merkle - Intro to Nanotechnology

/core-Jul6-NCS Andrew Minor - Nanomaterials (third speaker)

=============== End of PRE-presentation notes

9:10

Her Genetics Blog:

Thank you. Who spit? [almost everybody]

Now service offered for $99.

Bit of backup at the lab.

Q: Is it possible to get back the raw data?

Yes, you can download it.

We had the wording wrong, so we had women in their 80's downloading data and not knowing what to do with it.

Background on 23andMe.

About 20 min of presentation. Rest for conversation.

So, just to go to the very beginning,

why start:

Had to do with work in biotech toolspace.

Tools to study DNA at molecular level.

History of working with research community.

(, Perlegen Sciences, )

Hitting up against wall of frustration.

Could read genome with Applied Biosystems [ref]

Set budgets are impossible

Very intrigued to read genomes of people with the disease

GWAS (Genome Wide Association Study. www.genome.gov/20019523)

So genome wide association study taking off in 2000.

Guys get grants back, cut in half.

Statistical power was being eliminated due to the budget.

Trying to identify cohorts.

Disease studies had very low N.

Ad in Science: If you have enough people in a cohort, let us know.

Only one person at Mayo had 300 Parkinson's. Matched with discordant ...

Funding from Michael J. Fox [ref]

Probably not study design, not enough to \"move the needle\" on this disease.

/

Met Sergi Brin.

MJ Fox people funding work. Sergi came to that meeting.

What he was thinking: Mother had Parkinsons.

Typical survey - what is P value to make genetic associations?

Tried to get him to meet statisticians.

Through that process - Google should be in genetic research

Incredibly powerful.

Get admin group lsa@ - sending e-mail constantly.

Finaly got traction.

Began conversation - Anna Givsky? who became my partner

We wanted to mix up things

In early days not so much about giving access

in 2006, familiar how little we knew about genetics.

Pharmacogenetics - how our bodies respond to drugs.

Hard to study - small numbers with severe side effects.

10,000 on drug, enough to find few with effect.

A that work, for so many drugs, you conclude -

we have a long way to go for personalized medicine.

We are sort of ginea pigs.

Q: Possible placebo effect?

Really good question. At perlegen

(patent: 7,335,474: /patents/7335474/claims.html)

Either remove placebo effect people or know who they are.

Put some on the drug, osme not, do nested study.

Problem of research.

Interest in 23andME. Russ .. from Stanford.

Get all ph.gen studies. He was important advisor.

Design types of beneficial studies.

Big issue: you take drug, have good/bad reaction. More fundamental: how do you define disease.

Our definitions are 19th century. Symptoms.

Parkinson's - different versions.

LRRK2 - with certain variations - Sergi and mother both have gene.

Other people with disease - not associated.

Could be different drugs. Different treatment profiles if you understand the genetic profile.

Bryce: To have a disease is to have a genetic trait. Create unnecessary fear?

If portrayed correctly. It is a risk. Not absolute. Must be written in the right way. If I have this gene, my risk is increase by a certain amount.

Find people with gene, never got disease.

Man, age 70, whose father had Parkinsons.

What stops it? Lifestyle?

FoSS? Genetics.

You have your genetic profile.

you are at liberty to fill out survey on line.

Punch - like.

Research snippets.

Kind of fun. [ref]

Things you have been diagnosed with

Building out phenotype for you,

early association. Can you smell asparagus in your pee?

Two asparagus spears joke, \"Can you smell the humans in your pee?\"

150 studies going on.

So many people, over 50,000 now.

Hope more disease related publications.

Eriksson et al., \"Web-Based, Participant-Driven Studies Yield Novel Genetic Associations for Common Traits\"PLoS Genet 6(6) /article/info:doi/10.1371/journal.pgen.1000993

Having been at that for 4 years.

Stable

Building database

User interface had really evolved

Look at original - it was hillarious / antiquated.

Had mission now to develop concept in not-for-profit way.

Always get profit question.

In HC space, if for profit -> distrust.

Not customer base, but outside.

Still, lingering questions about model.

Brainstorm research foundation (/)

Autism, bipoloar, diseases of the mind. Challenging.

Need to focus.

Model where people can join the foundation.

Tools to track own brain health.

Inhereited genes.

Are there markers for dementia?

Are there markers for decline, poor mental health? Make available for research.

Different brain exrecises. Do they work?

Physical exercise is better.

I'm a runner myself. Can change whole perspective.

Tremendous number of calls. They think I just give out money.

Can project manage things.

Foundation 2.0 - no overhead. All money goes to specific projects.

Cohort for Alzheimers.

I'll go to full genome sequencing.

Thinking about how to organize genetic data.

At least 5 companies [refs]

See Third Generation Sequencing

(overview article: /news/2009/090206/full/news.2009.86.html)

on next-next-generation approaches to low cost geneic data)

Net-Gen includes Illumina, Life Technologies, Roche/454, etc.

Next-Next-Gen includes Helicos, Pacific Biosciences, SZ Genomics, Halcyon Molecular, Lightspeed Genomics, etc.

/

See groups with inside knowledge.

Created this model now.

Immersing in FaceBook, Twitter, tried Buzz - it didn't work.

See how people engage each other.

FaceBook is the best place for Brainstorm.

None of the data will be stored there. Just a marketing platform.

Ad system: target age, sex. Tells how many people.

highly recommend it.

Study innards of social netwrok.

Pwerful way.

29 m. Aged 40-55.

Alz - few 1,000s

Not influx of data about various diseases.

that will be first

get ad revenues going

test to see how that works.

Raising money to get people screened. APO4E+ [ref]

Or other reasons for concern (family member)

Very project based.

Concept people can get their heads around.

Better than not having accountability for donations.

Would love questions.

I'm here and willing to chat.

Q: Loads of questions. What dataset do you make available?

At 23andMe. No data are made available. You could pose a question.

Propose a survey. Negotiating that.

Interesting thing on bioinformatics. Not many capable. We have people with math/stats backgorunds.

They take piece on, give you ffeedback.

Early stages for outside research project.

We feel strongly about security.

But also give opportunity to pose questions.

Q: David/NZ: As I understand it there were countless SNPs you could have chosen. If I do my test later, more details?

We are on version 2.

When we - setled on Illumina - you can pick. 550,000 SNPs on an array.

Did not meet our needs. We wanted mitro- and chromosome.

Our scientists picked 30,000 on V1. Appended onto 550,000.

All of the SNPs known - single gene disorders. Rare.

Now able to report carrier status for extremely rare diseases.

For people that find that out, incredibly important.

Most people - so what? - but interesting experience at Mayo clinic

Anthro/ethicist. Carrying sickle cell. Questioned sample. Looked at blood under microscope, saw sickling.

Diagram - paints chunks of different ancestral origins.

She had big African chunks she didn't know we there.

This dataset has enabled that ability.

Q: Why not more psychology oriented surveys?

Priorities.

Small team.

Really swamped.

If you've got one to propose ...

Q: with new stuff, how expressed ... twins, if discordant,

Full genome sequencing.

Jumping genes. Transposons [ref]

Tumor versus

Neurological diseases.

Tougher.

Q: Erez/Israel/biologist. Genetic testing big on pre-natal screening.

People not wanting to be tested due to insurance.

Major opportunity for 23andMe - sequence without information being spread. Know whether kids about to be sick - abort or not?

More and more of those. Part of that dataset. Becoming more powerful.

Will be in J in October.

Q: Sasha/Canada. What are you dling as leaders in space to make it mainstream?

Just launching compnay was startling. Took people by surprise.

Google as partner.

With the v

Make more appealing.

Cost issue - insane response at $99.

Not just geeks in Bay Area. International.

When word gets out, spreads like wildfire.

Regulatory issues.

More heavy hand.

Met with FDA to let him know what we are up to.

Pathway,competitor, kits at Walgreens. BAd reaction to that.

Prompted FDA to step in.

(FDA Letter to Pathway: http://www.fda.gov/MedicalDevices/ResourcesforYou/Industry/ucm211866.htm)

I believe it needs regulating in sensible way.

Key to continue research part of it. Press doesn't write about that side.

We want to get word out, but take measured approach.

Q: Brad/US: Release anonymously for other researchers.

No.

Will keep data secure.

Study - possible to go in and identify people.

De-identified data is kind of a myth.

Census data can be queried.

Better model.

Q: Linda, this is fascinating. Social sphere. Marketing in social network space.

Have you thought of Facebook as a way of organizing or even fund.

Kickstarter

One way to drive thigns forward.

Great idea.

how do you get people who have already expressed interest.

Alzheimers networks are pretty active.

Meeting in France. We need an earthquake in Alzheimer.

How can you create a \"Health Quake\" [Hmm. Remember the USGS \"did you feel it\" tool?]

Q: Norm in screening.

Two tiered - get feet wet, but don't want to pay for sequencing.

Need to have really high confidence when reporting back.

Genotyping is very accurate. Well established.

Rather than be at leading/bleeding edge.

Two tier - low cost genotyping, higher - $1000 - for full seq.

Q: Meeting next week?

So, one thing that happened with legislative

Alex Pedilla, California State Senator, SB482 Personal Genome Tests http://info.sen.ca.gov/cgi-bin/postquery?bill_number=sb_482&sess=CUR&house=B&site=sen

\"[This 2009 bill would have provided Californians the consumer and privacy protections necessary when they seek to obtain information about their unique genetic makeup and hereditary predispositions from companies offering these services. HELD IN COMMITTEE]\"

Old/antiquated. Paternalism needs tobe weeded out.

Continue conversation.

Community outreach. What we are proposing in a new bill.

Room for change.

Meeting around that topic. [ref]

Q\"Bryce: Agree on legistlation.

Getting big enough chohrt. P Obtaining consent under the structures of the Declaration of Helsinki \"Ethical Principles for Medical Research Involving Human Subjects\" http://ohsr.od.nih.gov/guidelines/helsinki.html)

Other countries may not have the capacity to process that much data.

Family members.

Paradigm of informed consent can stand?

Early on, had form. Very straightforward to opt into research or not.

You are joing 23andMe and we do conduct research.

Not clear cut enough.

Commercial ERB (ethics review board)

No ideas what survey we would put out to people.

First meeting, early '07. My daughter has a genetic disorder.

We've got ERB approval now.

New consent form launched last week.

ERBs are trying

Rolling consent is fascinating.

(see 2006 interview genetic ethics: http://bioethics.georgetown.edu/pcbe/transcripts/nov06/session4.html)

On panel.

People can change their minds.

Coming up with ways for people to change their minds.

What would be models for that: enought privacy and yet contribute to research.

Q: You sais anon is mythn. Yet de-identified - hard to connect to person.

Rolling consent means wyou want to get back in touch.

Conflict - maintain consent .. practical conflict?

At least 23 very closed model. Not open to public domain.

Even in company, we store personal information - credit card - separate from genetic data. Only scientists have genetic.

IRB ? approval

i think we have decided to just take this model for now.

ee how it goes.

News feed created uproar. Will shift with time.

Q: Julielynn Wong/ Canada/US: Modern age of social networking can give response bias (but large numbers). How are stat dealing with tat?

Since i'

Clean up dataset by analysis.

Do you have blue eyes yes/no.

If conflict, their data may be ignored. Are they giving what we think is an accurate answer.

Cohort changes every day. P value changes. Plot is interesting.

Can you sprint? Frame of reference. I kicked butt in 100 yard dash.

My dad. Baseball player. Didn't have even one copy of the gene.

You almost have to have that gene to compete in the olympics.

Curvy/wavy hair - image comparison is helpful.

Certainly room for error.

Is larger less clean better than pristine?

Wikipedia vs encyclopedia

Tools - without preconceived notions.

Q: Derek/Canada: Can you talk about how Brainstorm foundation is going to include external data sources. Integrating with George Church's 1000 genomes project /wikipedia/en/wiki/1000_Genomes_Project

Capability of uplaoding

DNA nexus model [/]

Works across platforms. Make it universal.

Then I don't have to raise money to get them sequenced. REally helpful.

Q: Raymond: Loved that data on chip is open.

Almost anyone else who has done things commercially has not done that.

A lot of debate?

Leting people see data?

Right off the bat. We wanted our own data.

Fundamental right.

They paid for it, they should have it.

onus on us to make interface place where they want to keep their data.

Make interface interesting and usable.

More coming out.

Updates all the time. New rports on weekly basis.

People think - log in, see what they see, So not true.

Want to make suer everyone is aware of that.

Chiara: You don't get data at lab. I pay you to know what is my genetic info. but if I am a researcher, I cannot get. It is not really open source.

Your data beling to you personally. If you download data and give to researher.

Bryce: Can researcher come to you? Ask you to send request for consent?

Main thing is if customers are OK with that.

As you go into the community.

Over 4000 different conversations, back to 2006.

Parkinsons.

If everybody saidk Hey, we like this guy down at UCLA, let's send him our data, you could do that.

BrycE: 300 person dataset. If people are mallicious or ... giving data not your own.

More rare diseases. If interesting from fresearch perspective ..

Surveys article on Wired cover this month (/magazine/2010/06/ff_sergeys_search/all/1)

How quickly we could come to similar conclusions.

Guy had answer in 10 minutes.

What questions would you like to pose? Proactive. Keeps data very secure.

Q: Rand.

10:09 Break [23 on pad]

10:17 Lori Giver (/)

- The Evolution of Directed Evolution

First things first. Evolution in the laboratory for industrial purposes.

- Corporate Phylogeny

More general talk for this audience. How one person can have impact on the world. Zaffaroni - I'm a local girl, born in 1968. Very different area. Biotech grew up here organically. Zaffaroni founded ALZA. In blue shows how companies were acquired.

- Alejandro Zaffaroni quote 1

One of my colleagues had this great quote. Be exploring new areas, fail safely. Found another quote:

- Alejandro Zaffaroni quote 2

(AZ: Biotech Hall of Fame: /exhibits/biotech/zaffaroni.html)

In looknig for people to run new compnaies. Broad perspectve.

- Codexis Technology

We are focused on optimizing bio catalysts.

Almost all talk about individual enzyemes.

Why / how / how changed in 20 years / where 5 and 10 years forom now

Not a pharma co.

Active campaign in biofuels.

Exciting new projects I won't be able to talk about now for carbon capture.

- Why Biocatalysis?

Why use rather than chemical process. Variety of reasons:

Cost

Quality

Not extreme temperatures.

Not toxic.

If you can get reactoin done for you, will make the desired compound, not as an enantiomer[?]

Rarely something they can throw in, see how it works.

- Sources of Biocatalysts

Several approaches.

Look in natural diversity. Lot of activities inearly 90's

People out there digging interesting organisms out of hot spring.

Thermophylic

Extreme Ph, high temp, low temp.

If looking at extremes, know what is extreme here on earth

Went to school in Indiana [ref]

to work on that.

Second approach: build enzyme yourself.

We don't know enough about how they fold and function.

Protein Eng - evolve to what you want it to be.

- Protein Engineering

Most don't do what you want. Traits need to be improved.

High fructose corn syrup use.

Dfficult - 300 amino acids. Basically a lot of ways to modify.

How is it possible to screen millions and millions of variants.

Lot of ways to bring it down to a managable problem.

Ways it may not be doing what you want it to do.

Try to make it do what you want.

We just don't understand enough.

Molecular evolution.

Screen for those you want. Keep building on that.

- Approaches to Protein Engineering

- Evolution by Natural Selection

Older work in population genetics

A lot of improbabiliteis

- Classical Breeding Yields Novel Solutions: Horses

In nature, this works very well. Progenitor eohippus. Very different breeds.

- Classical Breeding Yields Novel Solutions: Dogs

This is the wild type dog. Over many generations of breeding and selection you get functions and non-functions.

How to do this in lab on much more rapid scale with genomes?

- History of Directed Molecular Evolution

Late 60's - people training on RNA replication. Pick molecules which replicated more quickly. Depending on selection pressure, should be able to force them in different directions.

Phage - which can bond to ligands.

Then in 1990, pubs from Tuerk and Ellington - select for different properties.

Shortly a ... inhibit biomolecules.

1994 DNA shuffling.

- DNA Shuffling - 1994

Take molecule. Recombine it with itself.

Extraordinary.

Lot of debate. Would this work? People were up in arms.

In the Nature paper - example.

- \u03b2-Lactamase evolution

Took antibiotic resistant organism, selected for higher and higher levels.

32,000x capabilities in just a few generations.

This was phenomenal.

Lot of concern about resist organisms.

Quote: \"very powerful ... potentially dangerous\"

- Recombination: Why Sex is Good

Why works so well.

Make random mutations.

Take best you can find.

Repeat.

Small steps up to fitnes.

In Shuffling. Take everything that has improvement, recombine Not rediscover beneficial mutations, just recombining. Gives leaps.

- Directed Evolution by Classical DNA Shuffling

Genes can be 60% identical.

They could also be point mutations.

Very very similar.

In lab, randomly fragment. Reassemble into full length.

A library of genes.

10^2 to 10^6 genes.

Piece of gene will not translocate.

No deletions or insertions.

Most will be interesting new variants.

Other approaches truncate.

Put into host, make into protein, repeat process.

- How DNA Shuffling Improves Genes

Smiley faces are mutations.

Blue good.

Red bad.

Method gets the bad ones out.

Other ways don't allow for getting out deleterious mutations.

- Semi-Synthetic DNA Shuffling

Around 2000/1 went to semi-

one gene of interest.

Oligos incorporate themselves at different rates

HTP [?] screening.

- Advantage of Semi-Synthetic Shuffling

Shuffling of 10 unique mutations, one from each of 10 genes.

Reason it works better.

Each with a single mutation.

Price and cost hasn't improved to much (potential problem space)

Semi-Synthetic Shuffling Acceslerates accumulationof mutations

BUT, how can we know which... (see slides)

- ProSAR: Protein Sequence-Activity Relationships

A statistical model that correlates sequence with function.

WHAT THEY DO NOW: They sequence variety from the process and code for that. For every gene we have they will know how active it is or its relativity to its parent.

What is the mutations impact on the gene status??

- ProSAR Model: Alignment View

Color coded ranking of correlation coefficients

All you can do is try to replicate the key parameters as best you can.

- Directed Evolution Technologies

OK, after ProSAR analysis, we've changed how we do our process.

We are thinking about mutations all the time.

Which are most beneficial.

Designing new libraries to keep building on that.

If I take this mutation and stick it into that gene, it may help, but not sure.

Always designing libraries, not trying to make one perfect gene.

- Evolution of Directed Evolution

This changed our view of how recombination works and how to make it work more effectively. Which are beneficial mutations even if they are in genes whcih are less fit than we started with.

- Modern Biocatalysis Paradigm

Changed to new paradigm.

Design around available - > design process you want and we'll build biocatalyst.

- Going Green Keeps Getting Easier

This compound, C5, they were sourcing, put into product.

Designed 3 enzyme process.

Convert to alcohol, then ...

Won award. Big publish for us.

- Chemical Cyanation of ECHB

Pfizer doing that with process from Mitsubishi

You can make a whole lot of things you don't want.

Volume fractionalization needed. Better to make ti more economical.

Q: Talk about Going Green slide more.

Went through really fast. Really important.

i'm leaving out that, at the time, big blockbuster drug.

Mfg of drug - if changed, require

- Enablement of Biocatalytic Cyanation

- Climbing Mount Improbable*

- Diversity Generation

- Automated Parallel SOEing (APS)*

- APS Formats

- APS Workflow Accelerates Enzyme Evolution

- Project Example

- Sitagliptin: A potent and selective DPP-IV inhibitor

- Merck\u2019s Current, 2nd Generation Process

- The Aspirational Process

- Problem and Approach

- Establishing Activity on the Pro-Sitagliptin Ketone

-

-

- Compounded Fold Improvements

- Summary and \u201cFinal\u201d Biocatalyst

- Future Opportunities

- Protein Evolution

- Sugar Platform: Key Building Blocks

- Major Constituents of Cellulosic Biomass

- Cellulosic Biofuels Basics

When you are trying to create biofuels, try to break down cellulose.

Chop up, get slurry. Most sugars not available.Working on whole suite of enzymes.

Feed organisms to create second generation fuel molecules.

Whole area scaling to work on genome level.

Kind of same level as gene ing omex? technologies.

- Acknowledgements

That's it.

Lot of Codexis and Merck collaboration.

11:13 5 minutes of quick questions.

Q: Tony: How far are we from doing eugenics for humans?

I think we are doing genome evolution at microbial scale.

Yeast. Starts to rival human genome size.

Which ones are beneficial mutations. You could do them on any type of genome. Whether you would or not is another question.

We have been able to expand out.

Right now, it is not infeasible.

Take microbe which makes ethanol.

Train a yeast to use zylose. A few changes have to occur.

Just train it.

Do full genome sequencing and produce variants.

Moving on to humans, it is just more sequence.

Talk before - will be affordable soo.

Q: Sasha: Most of execution is done in controlled settings. Biofuels.

Unintended consequences, environmental space. Mutations, reactions you didn't expect.

These 5000 l reactors ARE reactors.

Bioremediation.

Can you grow algae. It needs to be OUT.

They need light.

Generally, right now, there is no release of recombinant organisms.

Not in the projects we do or the projects we plan to do.

Huge opportuniteis there, but engineer so they can't compete with wild.

have to be hampered. Keep them from exploding out wildly.

Q: Chiara: If I understood well, when you test on plate, why don't you usea 3D system. If not, why not?

We did a it of work awhile ago. Really interesting. 430 O plates stacked.

Visual indication of which working

Right now, we are not needing to push number beyond rountine.

Haven't been pushing teh 3D approach.

Depends on screen and what you are trying to look for.

Q: Erez/Israel: Thank you for very interesting talk. invented something similar to PROSAR 8 years ago. Interesting to see it again.

Revisco. Part of photosynthesis. Passive enzymes. Project with Rio Tinto. Can you improve photosynthetic organisms. Very challenging.

A tetramer of octomers. Almost every residue - very easy to cripple that enzyme. Hard to improve it.

/wiki/RuBisCO

Might be worth another look now.

How they might use - photobioreators or what they would do.

Q: Screening. Specifically which is going in silico.

We don't do any in silico for enzyme function.

Others try that. Go into lab and synth top variants.

Even those suggest, interesting starting points for directed evolution.

Lot of in silico screening - didn't need to do that.

Raymond: Thank you Lori.

Couple things as takeaways:

directed evolution - don't need to really know how it works to improve it.

DNA synth still a blocking point

Improve through automation.

helpful review article(s):

Tracewell and Arnold 2009 \"Directed enzyme evolution: climbing fitness peaks one amino acid at a time\" http://www.che.caltech.edu/groups/fha/cara.pdf \"Evolution has created numerous specialized enzymes that function in living cells to catalyze the chemical reactions of life. Their specificity is tuned so that they generally do not tread on each other\u2019s toes. But that does not mean their specificity is absolute: a recurring observation has been that many enzymes have weak activity on non-native substrates and that directed evolution can amplify these weak activities.\"

[11:24] Break

Up next: Nanotechnology

NT CL4 DNA Origami (Paul Rothemund)

11:32 Merkle: Everyone back for next talk.

Brilliant, fascinatingand delightful.

You will not want to miss this speaker.

Folks in the lobby - come back, come back ....

Alright.

Honor to have Paul Rothemund (properly pronounced Rote-a-mund)

Grabbed cover with smiley face.

Brilliant accomplishment.

Labs said, \"You can make a smiley face. You can make anything\"

Those in the field were kicking themselves because they said \"If only I'd realized you could make smiley faces!\"

Giving talks all over about the inspiration of how he came up with this idea

It's a great honor to say we have Paul here to explain what's going on.

[11:35] Paul:

- Beyond Watson and Crick: programming DNA self-assembly towards integration with nanoelectronics

This event is about thinking seriously about the longer term. A kind of event we should have more of, but not a new idea. You should read \"Future Shock\" by Alvin Toffler.

A lot of the lessons of that book are applicable today, so I'd encourage you to think about them.

The Singularity is a science fiction concept. I'll indulge the science fiction desires for a second.

- Before I die ... I'd like to see humans:

I'd like to be able to program biology with the same facility with which we program computers.

We'd like to be able to create whole organisms to specification.

I'd like us to find ET life.

I'd like us to create AI.

I'd like us to find ET *intelligence*.

I'd like us to create an equitable social operating system, allowing every person to live up to their full potential (i.e. world peace).

Oh, and a pony.

What if anything does nanotech have to do with any of that? And do our predictions for the time course have any bearing on reality? Are we calibrated for that?

-

I work on things that go towards the first two -programming biology and creating life.

-

A comment about programming vs Programming. Little-p programming is like a VCR or a chemist specifying a particular structure. Some finite set of possibilities. Specifying when your TiVo is going to turn on, that sort of thing. Capital-P Programming is the computer science sense - anything you can do with a computer - Turing-complete programs.

- \"Synthetic biologists\" \"Molecular Programmers\"

A whole bunch of people are synthetic biologists, and a bunch of people that don't know what they should be called but synthetic biologists let us hang out with them. \"Molecular Programmers.\" Mostly biomolecule-oriented. I want to give the sense that a lot of people are working on this stuff. I'm on the molecular side - changing the actual substrate for the things we're building.

The field I'm part of is DNA technology and DNA computing.

- For 30 years, Ned Seeman and his descendants

Seeman succeed in making enormous complex DNA polyhedra. That's one subfield of DNA nanotech: how do you encode in molecules strucutre.

My part of the world is function and dynamics with DNA.

- (p)rogramming Function and Dynamics - 2000, physicists

Bernie Yurke made a little DNA tweezer - 50 piconewtons of force - pretty respectable on the atomic scale.

Then others made it into walkers and little Rube Goldberg machines.

- (P)rogramming molecules to perform computation - 1994, computer scientists

The third strand is programming molecules to perform computation - DNA computing. Was heralded as a competitor to electronic computing. What happened? Many ways to compute with DNA, but none were competitive with electronic computing. For all the methods anybody could dream up, it didn't seem we could come within 4 orders of magnitude of electronic computers.

But at a molecular level, a little computation goes a long way. Cells have to decide what kind of cell to be, and that's transacted by a little molecular computer inside your cells. Cell divison - an elaborate choreographed dance - regulated by networks, possibly modelable as circuits - are mediating that as well. Our interest now is to do just a little computation in DNA and use that for other little molecular machines.

Q: How do inputs come? How are they processed?

Set of sensors sense food. Transducers bring that into cell.

Then there's a complex cascade of proteins that [...] motors on the end of the bacteria. In this way bacteria can move up chemical gradients, getting closer to a food source. It costs energy to make the machinery to digest certain kinds of food. If there's a new kind of sugar around you need to switch your metabolism. So you have sensors for those sugars, and a regulatory network that interacts with the genome, turning genes on and off depending on what's around.

Decisions made at molecular level that are just decisions. Not like a chess program.

It's a relatively short computation. Doesn't have the depth of a chess program or something like that.

- All three - structure, function and computation - are necessary for the creation of systems with the complexity of living systems.

So we're taking a crack at all three. The reason we use DNA is because, while we have a field of protein engineering, we understand DNA a lot better and can do a lot more with it. It's an approachable substrate to actually do engineering in.

- It's .. skip this

- Catalog of molecular parts (Goodsell, /pdb/home/home.do)

There's a photosensor in cells. There's a light-harvesting complex. There are switches. Signals come in, there's computation that's performed, and it's decided whether to turn genes off.

There are girders - protein filaments that are quite stiff - and motors, proteins that walk along these protein filaments.

- DNA bricks - Symmetry sets the stage

DNA strands bind and wrap around each other to make this little brick.

They're single strands - not double helix.

Brick has four sequences on its edges. By giving each edge a different sequence, it's possible to program this object - in the little p sense - to make interesting structure.

In one case we programmed them to make crystalline tubes that are similar to those proteins in biology.

- [diagram] TTACG

- [photo of DNA bricks]

We could use two different ones to make walls with diagonal or perpendicular stripes...

The point is, we can begin, with DNA, to recapitulate some of the forms we see in biology. These DNA tubes are about as long as protein filaments, and almost as stiff. Nobody could make a de novo protein that would be anything like that. This is the power we see with DNA nanotech.

- 5-fold \"star\" monomer, spontaneous symmetry breaking

We can also make pretty much any wallpaper pattern you want - can design a little DNA brick for any pattern. But we're not just interested in repeating patterns - only good for very crystalline memory. I worked with Erik Winfree at Caltech to do Programming - embed a computer program in those DNA bricks.

- Algorithmic crystals that can simluate cellular automata

- [zoomed view] Pascal's triange modulo 2

[Sierpinski shown]

4 different types of bricks in here. As they grow, they begin to compute. What they're actually computing is the form of a fractal - it's got errors, but - it's the form of a Sierpinski gasket. They're performing a binary computation and leaving this pattern in their wake. It's the binomial coefficients - a somewhat useful pattern. Much more complex than the periodic patterns I talked about before. As these little bricks self-assemble, rather than just making a boring wallpaper, you could use it to lay out a complex circuit. Won't go into how we're doing that, but that's one model.

The thing is that it turns out that this algorithmic self-assembly from Erik is useful for building very large objects that have some structure, but not useful for arbitrary structure at a small length-scale. You are grown in an algorithmic way. Genome - 3 bln base pairs - a process called development grows it into you, and the genome specifies you vs an elephant. You are much bigger than the genome that is used to build you. The genome gets decompressed into a very large structure. But at the smallest length scale, you want something with some random structure - maybe any pattern that you want to make - not suitable for algorithmic.

- So we can

- [long strand]

- [short stands]

My approach to arbitrary patterns is what I call DNA Origami. This is a long single-strand of DNA. A very small piece of a 7000 base-pair strand. You can imagine it stretching all thw ay around the room and meeting itself on the other corner of the screen. We use short strands of DNA to fold that very long strand of DNA. We call the short strands staples. The left half of the staple binds the long strand in one place, and the right half binds the long strand in a different place.

- [long strand bound by short strand]

So it enforces a constraint between them and binds those places together. The net action of about 200 of those short strands fold the long strand into some pattern - for instance a rectangle.

- rectangle

- Shawn

- [cartoon animation of molecular self-assembly of what it must be like.]

You can see as it goes on some double-helices forming...not complete double-helices, but they're held together by what are called crossovers. Where a strand is held by one part of the long strand but then jumps to another helix. In this way we make something that approximates the shape we want, but all the individual pieces are mostly making double-helices, which is what they want to do anyway.

We actually don't know that much about the detailed trajectory that this process takes over hours or days - they're probably binding and unbinding all the time.

- [animation of long scaffold shape - arbitrary shape - smiley face]

I wanted to show that this really could make arbitrary patterns - structures that weren't just convex - had holes, and other things. So I decided to make this smiley face. To give you an idea of the lengthscale. This is 100 nm across. 1/70th the width of a red blood cell. Very small. How do you see it? With an AFM (atomic force microscope).

- http://virtual.itg.uiuc.edu/training/AFM_tutorial

AFM using a very small micromachine needle, dragged back and forth across a surface. (So we have to somehow get the DNA from solution onto that surface.) As the needle hits the surface we can measure the deflection. So we have a method - could have been done in the 50s - very low-tech, amazingly - for seeing what hapens.

- [100 smiley faces floating around]

How do get onto the surface? You wash the solution over mica, which is very flat. The DNA origami stick to it, and then you can take an AFM image of that surface.

- [arrangement of smiley faces]

Look at the image, and you see smiley faces. They aren't perfect, but 72% are what you wanted. You can actually see the path that the scaffold takes and you can see the little unfolded bit at the bottom.

- A catalog (again) [with smiley face overlay]

To compare to other things that we're trying to recapitulate in biology, we're actually beginning to engineer and make arbitrary shapes at that level. We cannot make things with the fine resolution of proteins. We can't begin to approximate that. But we're only about 10 times larger.

- a, 12.5mM MgCl2 [with triangular shapes.

If you make a structure that's more rigid than the smiley, you don't have this problem with the structure getting busted, and the yield is more like 95%. It's really a defect of the weak smiley face that we don't get a higher yield.

- image - looks like map - China! Lulu Qian

Even put Taiwan on there.

Completely replicable. Just made what she wanted.

- crosses, girders

Since people have done all kinds of things - 3D structures- William Shih. Rigid structural elements, crosses, girders of all kinds. They take about 2 weeks to fold, but you can bring all these helices together in this tiny space and make amazing things.

(see http://researcH5.dfci.harvard.edu/shih/SHIH_LAB/Home.html)

(see CAD Nano /)

- 3D structures - machine walking along protein track

The major thing that it's going to do is custom instruments for biology. Up here is a 3d shape that makes a little track. He's intending to use these as tracks for proteins. The goal is to use these as probes for what happens in actual biology. There are lots of questions about protein walkers. And one way to answer them is to make tracks with different steps. If there's a bigger distance, maybe it would walk faster. Or maybe it would fall off altogether. We can't engineer the tracks as proteins, but we can engineer DNA tracks. We can put protein walkers on them and watch them.

It turns out the protein engineering actually is good enough for this. But it gives you the feeling that this is the kind of thing we're going to do.

- Custom instruments for biology

Another example - a Japanese group -Endo and Sugiyama - they made a DNA picture frame. Two wires going across it are DNA double helices. One is short and one is long. The long is loose, the short is taut. And when you put this red enzyme that puts a mark on it, it will modify the loose one but not the taut one. Another enzyme that cuts, won't cut at the mark, but will cut the taut one. We've made this custom jig that allows us to probe the activity of enzymes, in a single-molecule setting. We can really begin to interact with proteins in a much richer way - answer complicated and subtle questions. One of the fantasies is that this will be the first thing biologists think of - that when they want to study what a protein's doing, they'll make a DNA origami custom instrument.

There is a CAD software for these things that you can download and play with /intro.html

-

- DNA boxes

- Lund, et al, 2010 (Stojanovic, Winfree, Walter, Yan)

Referencing a couple papers at the end - DNA strands hanging off origami, protein with flourescent markers, and arms that can cut the dna strands, and they can have proteins walking along the DNA origami, a hybrid protein-DNA walker. A synthetic system for studying artificial molecular walkers. People have even made walkers that pick up cargo and put it into a little package. We can talk more about that offline.

- Each staple goes to unique position

-

-

Let's talk more about DNA's patterning ability. You have a bunch of staples that will end up in a particular position.

- Shapes

So you can make patterns. You can make a snowflake pattern or the americas, and you can spell things - you might think it's just artwork, but artwork is exactly what we need for technology: photolithography for microelectronics is a way of taking artwork and scaling it down.

- chip

Wires and switches are printed in metals and semiconductors. If we have a better way to do that at a smaller scale we could make better faster computers. Fantasy of putting functional components on the DNA.

- each component

- Two dimensional organization of carbon nanotubes on DNA origami

We've started to make halting steps in that direction - nanotube transistors this way? Put nanotubes on DNA sequences that are complementary to bits of DNA origami. Should organize the tubes into a cross, which for the right kind of nanotubes is all you need for a transistor. We did that and you can use a special tool to write electrodes to it. You can connect up to it, and you can measure that you can switch. So we can make a transistor this way. [Aside: When we did this work, we were having a problem with aggregation, and this DNA ribbon made them more stable for unclear reasons. Potentially not necessary for this system.]

- The Design ...

- Benchmarking [slides not shown, skipped]

- Two dimensional organization of carbon nanotubes on DNA origami (with AFM image)

However, the problem is you make these things in solution and they go all over the place. The great challenge is that you have to put these on a surface to wire them up, and it's like taking a deck of cards and throwing them on the floor. You have to find them! It's an incredible challenge. And they cross-link, aggregate, all kind of things.

- Two dimensional organization of carbon nanotubes on DNA origami (Hunt and Peck)

These electrodes were written down to the nano-scale - had to be done tediously by grad students. They made these beautiful crosses but it's impossible to integrate them.

- One solution to placement

Another strain of research we have is putting DNA origami where you want on surfaces. I did that with a group at IBM Almaden. You can use standard lithographic techniques to make sticky patches, so when we pour the DNA across they'll go exactly where we want.

- IBM group

- origami on surface

We can convince ourselves that not only do we get one origami for each hole in the surface, but we get 95% of them in line and where we want.

- combining placement (registration) with positioning of devices

The overall picture is that where we are in the end, we're going to make specific shapes that will bind to specific sticky patches. Then later we'll add the components that will assemble on top of the DNA origami. So we won't have problems with the nanotubes causing the origami to aggregate. We won't have to worry about drawing these crazy roads down to the devices with microscopy - we could build it in a very standard way.

- IBM Hung /Cha. Now at UCSD

People have extended this process, and people at UCSD have already put gold nanoparticles on these triangles. Beautiful orientation. We're actually beginning to organize little nanodevices this way using DNA origami.

- [three shapes - rectangle, smiley, triangle]

I would ask - what makes DNA helices come together. Ralph? Ralph: hydrogen bonds. That's wrong. Not that Ralph is wrong, but it turns out to be wrong. In the textbooks they tell you the major reason. it's not hydrogren bonds. The facility with which he said hydrogren bonds - I wanted to bring this out, a lack of understanding on the part of professional scientists that we don't really understand these molecules well enough to engineer with them. We've known that hydrogen bonds weren't major for hybridization for decades, but people don't keep that in their working memory.

- [three shapes - rectangle, smiley, triangle with photos]

The ends of the helices in the triangles are hidden in the corners. The ends are strick for each other, and that's the primary force that causes them to hybridize. 75% of the forces that bring DNA together are the lateral forces between the bases.

- Base Stacking

People argue about exactly what the nature of the interaction is - dipole, van der Waals - but we can measure it. The edge of a rectangle will stick very strongly to another DNA helix. The hydrogen bonding makes the specificity. If they can't hydrogen bond, it won't be able to stack.

- a b c d

It turns out, we've learned how to master this force. If you have a bunch of helicies they can click together.

- [lots of skipped slides]

- Triangles, one broken

Here is a DNA origami angle. It has a specific shape on it. The only thing that's holding them together are these stacking interactions.

DNA origami are not something we can simulate. We got to them by trial and error and by refining our intuitive model of what DNA can do. By adding stacking interactions we refine it even more. We can hopefully even mke machines parts. Things that slide. Maybe look a little like Merkle and Freitas machines. But we can't, from first principles, get to a predictive situation. No program can predict whether a long strand and a bunch of staples will fold.

We can build things we don't understand.

The best molecular modeling guys in the world can't help me do my job better. Instead, I'm helping them calibrate their models. That's probably going to be the situation for 10 or 20 years. The simulations are not capturing the fundamental interactions. Not to say anything bad about simulation, but that's how far behind the curve we are.

- Growth of design complexity

We have our own Moore's law - 50 labs pursuing this now, size of structures doubles exponentially.

- Before I die (again)

\"I'm going to die, probably within 1.5 billion seconds.\"

Before I die I'd like to see all the stuff [from list earlier]. But I won't. We'll have molecular manufacturing. Smalley is wrong. But we won't use DNA origami. Anything you see or think of today will be replaced dozens of times in the next decades. If I draw a picture of gears, or Ralph does - we're not going to build any of that in the future. We'll have to completely reimagine as we learn more. That's one of my main messages. We can't predict any of this - even if you only use the things you understand best, you're still going to get bitten in the butt when you go in the lab.

- Before I die (3)

We have all these exponential trends, but....I saw this talk that said protein folding would be solved by faster computers. But it's not. We can only do small perturbations. De novo protein designs - only two ever, and one was a fraud. All these things will come to pass, but maybe our grandchildren will see them. We want to figure out how to accelerate. The way to do that is to maintain civilization, give to science, get your hands dirty in the lab. DON'T GIVE BUILDINGS. Endow faculty, graduate students, specify they have fellowships for 5-6 years. There are a number of structural things we can do. I don't think I'm just blind because I'm in the trenches. We just don't understand things well enough. But I want to see it happen.

- Some difficulties

Don't go watch world cup right now.

- What we can do to accelerate progress

Wish we were going 10x faster.

Bryce: Population genomics.

To what extent, if that field grows, is it competing?

No.

David R: Speed to decode DNA underestimated due to things OUTSIDE field. Maybe new tools would help you accelerate?

Absolutely yes. Every few years someone comes out of woodwork and gives us something new. Even that is not enough. Sequencing, ... people were blind? Actually turned out to be easier problem.

Those are singular things. Typically they have to do with bits. \"Easy\"

Some of those underestimating things weren't engineers.

Can differentiate between easy and hard.

Merkle: Anything to do with bits is easy.

David H: DNA - 4 blocks. What about other non-organic building blocks?

Funny. Feynman prize winner. Does great stuff, but he didn't get tenure.

Thing is - a holy grail. Novel chemistries to compete with DNA. 20-30-40 year challenge to come up with polymer.

DNA and RNA are not interesting electronically.

People make little hetero polymers.

It would take an effort on the scale of what we've already had with DNA.

People want to do that.

Chiara: With DNA origimami - build circuit.

Encode - ACGT and compute with that. DNA computing field:

/wiki/DNA_computing

Haven't figured out way for it to scale yet.

Second distinct thing. Organize things like carbon nanotubes. Gold for optics. Organize a more conventional computer.

[12:42] more questions poll

Q: Emoticons?

Nice dolphins. Then dolphins together. Then university changed logo.

3D trojan horse.

Reason I did map of Americas. Wanted to do something more universal (rather than just a flag, say).

12:44 [applause]

Em: Reminder - workshop this afternoon not in 583C, but outside by building 20.

=============== DURING-presentation notes

Can't stand the colors of Etherpad? Turn them off with Pad Options.

(Note: this changes the color for EVERYONE.)

Color card definitions:

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Link to backchan.nl for questions:

http://singularity.backchan.nl/meetings/view/142 First speaker

http://singularity.backchan.nl/meetings/view/143 Second speaker

http://singularity.backchan.nl/meetings/view/144 Third speaker

GSP10 Book List:

http://bit.ly/GSP10BookList

=============== POST-presentation notes

Instant Evaluation:

/viewform?formkey=dGVzY3JzR3VFeTJjSElVcjM3REFpY0E6MQ

"

/core-Jul2-PLE

"Friday

7/2/2010

11:30-12:30

Brad Templeton/Lauren Gelman

PLE CL Introduction to Policy Law and Ethics

Slides: http://bit.ly/cYFnrT

Audio: http://bit.ly/cblVOU

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

Try backchan.nl here: http://singularity.backchan.nl/meetings/view/124

Computers let you do a million times for the same cost of doing something once.

Good useful things have become scalable.

Problem is, bad things can scale as well.

In old days, things didn't scale that way.

History of Law - been attempt to stop evil from scaling.

We are leaving laptops on desks because only a few theives around.

Most people mostly want to live honestly.

No need for guards.

Number of bad actors are small.

With scalability - one bad actor can be multiplied by a million times.

One spammer ...

We can also overreact. Go nuts. Try to lock down society because of fear.

Other ways to scale:

Recruit army

Organized crime

Corporation - sometimes good, sometimes bad vision.

Computers allow putting bad intent out in world

botnet

attacks

the great firewall of China - only possible in part due to scalability

Everything is copyable.

I forgot to do something. I talk very quickly.

Don't feel rude if you want to hold up a yellow card.

I want you to understand this material.

Our challenge is to find some way to fight it but NOT give up our values.

Risk of giving up, due to fear, of giving up advantages.

Specific challenges:

Inside other tracks, they will give you some material.

Things that can go wrong, what people will do, how to protect freedom.

One thing at EFF - intellectural property. We will give you 3 hours on this later in program.

Changes in copyability have caused rebirth in music and movie industries.

Book industry is heading into that now.

Design is going to be copyable. 3D printers - can copy shapes. Nanotechnology - nano forges - at very fine structural level. Starship Enterprise level within your lifetimes.

Imagine a Napster for Cars. Download this Corvette ... it's cool.

Issues that tore up music industry. Still selling more product.

Avatar - brought in 2 bn [ref]

Information/design can become abundant.

Also concerned about economy of creativity.

People who make money.

People who do expensive creative works.

Find that, without locking down technology.

If you accept possibility of human minds being copyable, ethics is fascinating.

Society definitely not ready for this.

What will be economically worthwhile?

What will be protected?

Via secrecy? Harder and harder in a world where nanobots can do complete reverse engineering.

Materials - some raw materials may be particularly valuable.

Q: List - replication / credibilty? Personal services?

By location, certain places will be cool.

As Lex Luther says: beachfront property might be valuable. Dubai had idea to create more beachfront property.

There will cool places.

Personal services.

Perhaps AIs will do services - even if you can get any physical object you will want to be waited on hand and foot.

We have an affinity for originials - as apart from an absolutely nano-level copy.

Part of a general value that is an aesthetic.

[/wiki/Whuffie /]

Lauren: Actions no longer attached to body.

Opens up question of whether reputation will be attached to you, have multiple reputations.

Do we value more the ability to be silly in college - or the opportunity to value of who somebody is over who they have been over time.

Q: About previous slide. What will be valued? or what will be valuable?

If material things become abundant.

Q: Value in the sense of scarcity and economic exchange.

Economic value. Right. Money as a proxy for those things.

Not what people will value in a more spiritual sense.

L: Can add power.

I like to think people think of power as a means. Some think of it as an end.

that is a \"spiritual\" value.

IP, first thing on list.

Once mfg goods are not scarce, they will want a system to control digital files.

DRM - Digital Rights Management (aka Digital Restriction Management by critics)

Can be sold without allowing multiple copies.

Trusted Computing

both light and dark sides. May make system trusted not only by you but by Microsoft.

Obeys you or betrays you.

If someone infringes movie copyright 3 times, person can get kicked off the internet.

Later generations would think of getting kicked off the internet like not being allowed to walk down the street -- pretty severe.

We've seen effort, basically, for tiny Hollywood to control vast SiliconValley.

$$$ value of entertainment is small relative to computer industry.

Yet, they say computers should be architected to our standards.

\"Change your technology to protect our old industry.\"

Clatyon [ref]

They think of anything. We can't let design of new technologies controlled by old industries.

You will see other tech that haave various forces, stak holders, that are oushing the alw, force these people to change their tech so that it will not iunerupt our industry, I understand, people who have been faced with these technologies I sympathize, but the reality we cannot allow our tech to be influenced by old industries

Patents.

Not all patents are wrong.

Hardware and software are the same.

Explosion - immense number. Many not good for society.

Cause fo this explosion - immense number of problems to solve.

Problem was new. They were first. Answer not that hard.

On-click shopping. Amazon holds this patent.

Not a hard answer, the question was new.

Patent office said, \"Is this novel\" Yes.

One thing about patents that I think is important

We've seen in patents an explosion, many of them bad and not even good for society, what we see now are more tech for problems, the problems are new but the answers are easy, we should push patents to be new answers to old questions

New answers to hard questions. Those deserve patents.

Different answers to what do you do to get money for creative work when anyone can copy.

Government pays everyone to be creative. Canada.

Get over it - no business will get copyright protection.

Micropayments - paypal but at 1/10th of a cent. Most people honest.

Some say iTune story, 99 cent songs.

Microrefunds - all with money back guarantee. Default is to pay, exception/explicit act is to get refund.

Trust public to be good. Symbol \"I'm a good guy who pays for bands.\" Tip jars.

Shareware. Voluntary payment.

You can use it for free, but it asks you to pay to register.

Patronage - used to be way - Mozart of something - you got a patron who handed over a chunk of change. Give wealth of creative out? Another question.

Sell tie-ins. Movies - Star Wars/Return of the Jedi - picked up extra money.

Shakespeare in Love -

/wiki/Shakespeare_in_Love

The producer at the globe theatre says, \"I don't know, it will work out, it's a mystery\"

Why do we care about protecting the stuff that people create?

12:15

Banning Genetic Discrimination

Henry T. Greely, J.D.

/cgi/content/full/353/9/865

Transhumanism

- life extension vs. \"necrophilia\" those who embrace death / after life

Think like a dinosaur [ref]

AGI

- slavery? Will we give rights to machines? Will they have possesions? Will/should we pause them?

Genero Sapiens - robot, perhaps cyborg

Homo Sapiens Effictus - clone

Is simulated water wet? Does chess computer simulate playing chess?

Dust [ref]

Will our tech betray us?

Will we build on tech that spies on us and invades our privacy

If you go to a priest who takes your confession, law says priest can't divuldge that info because if it wasn't private for priests, lawyers, doctors then they could not perform their job to the best of their abilities.

Why can't we have tech that does the same?

[end of presentation]

=================================================================

Question Template [for copy/paste - do not use]

Vote by adding +XX where XX are your initials (see key: )

Student Question:

Student Votes:

Student Comments:

Faculty Response:

=================================================================

Student Question:

Student Votes:

Student Comments:

Faculty Response:

Instant Evaluation:

/gsp10/feedback/week-2

GSP10 Book List:

http://bit.ly/GSP10BookList

"

/core-Jul8-MED

"7/8/2010

Thursday

9:00 - 10:00 am

MED CL4 Neuroscience Overview and Brain Scanning Technology

Chris deCharms

Email: deCharms@

Slides:

10:15 \u2013 11:15 am

MED CL5 Neuroprosthesis & Evolving Neuro-Technologies (Chris DeCharms)

Slides:

11:30 \u2013 12:30 pm

MED CL3 Personalized Medicine and the Experimental Man (David Ewing Duncan)

Slides:

/wiki/David_Ewing_Duncan

/

=============== PRE-presentation notes

Erez has introduced a new SUMMARY Etherpad:

/Pad-One-Liner

Please contribute.

Slide marker in Etherpad:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

[ref]

If you need a reference, use this marker.

PRIOR MED pads:

/core-Jul01-MED

=============== End of PRE-presentation notes

9:16 Keith: Medicine Track Day.

Couple of talks by DeCharms, then Duncan.

Personalized man.

Shorter lunch. 583C presentation by Balinski - world class animations.

Afternoon workshop of 8 different surgery, opthomology, critical care.

MS Skinput.

First two hours DeCharms.

Real time imaging of the brain. Book with Dali Lama.

Innovate work at Omneron?

Chris: Great to be here.

Talking about one of my favorite subject.

Who we are through the brain.

Movie - this is what it used to look like.

Take a space ship, inject it into the bloodstream. Science fiction.

Today, my colleague Peter - video of us actually entering his brain non-invasively.

Those are actual images.

Start out with real time imaging experiment in your own brain.

[exercise with closed eyes - opening is \"reboot\"]

9:27

Changes over your careers and our lifetimes.

I welcome questions as you have them. So many, we could spend all the time talking.

Ask burning questions, hold others.

What are the big questions of the brain,

we often hear about what we know.

-

Here are the open areas:

How do we choose the actions we take?

Just gave an exercise on consciousness.

How is that possible.

We're just at the cusp of having technologies to answer that for the first time.

We can make models.

We had to have a model of the past.

Where does that reside?

1000s of research papers on how you store the image of this room in your brain -- open topic.

How do we learn new skills? Still don't fundamentally know.

How is the brain laid out. Lot more information on that.

How do we use language in cognition. Despite tremendous progress, not solved.

How is it that we experience, touch, taste, smell.

When someone at cocktail party tells you about your reptile brain,

we don't understand how, when you open your eyes, ... this is beyond us.

Why do you spend 4-6-8 hours a day sleeping?

How do we make executive plans?

Key area for final talk - how are diseases mediated?

Everyone here has been touched.

1/3 to 1/2 of people in world

Nervous system has vulnerabilities.

-

When we can control mind/brain.

Imagine you could look inside your own brain and control love, free will ....

These exist in technology.

Reach in, 10 years from now, and fundmentally tune.

That is the promise of neurotechnology

I'm going to talk later on about changing the brain fundamentally.

Conversation about uploading brain to other systems.

We'll be living in our natural brains,

having our own subjective experience.

What technology and learning can help us to improve and regulate this system that creates who we are.

If we could do that, think of the diseases we could control

-

- Single Trial Learning: Forever Changed [black spots - looks like it has dog in it, sort of]

/albums/ee73/tricks-and-illusions/dalmatian-illusion.jpg

For those who have not seen this before

Studies with this particular image, decades later, you are going to see this dog.

Reason I point this out - your nervous system is fundamentally a sponge.

A change you can absorb immediately.

-

Another definition of what the singularity is.

Duality

What we call the Mind / What we call the Brain

Experience = Neurophysiology

Psychophysics Brain Science

Tools are trying to find the transfer relations between these two worlds.

How functions of brain ARE the mind.

Underpins what the Singularity is. Bridging gap between mind and experience and physically embodied world.

- Consciousness doesn't have a place in the brain

No local lession can take out consciousness.

Others can take out vision, or hearing

Much more complex than that.

One of the things happening in brain - new vista for cartography.

Mass of wires, connections, different from one to the next.

Fortunately, not how the system works.

Cartography - we now know what parts are involved in executive choices.

Still wide stretches - terra incognita - we are trying to understand.

Size of a large grapefruit. Hunk of meat. 2% of body mass. 20% of body's energy.

Holding one in your hand, it is amazing to think they held someone's entire life.

- Brain organization

Map to physical systems

- 2

Vision in the back.

Language happens here. Flipped left/right depending on handedness.

Touch happens on the top center of the brain

- Brain: Receptive Language

So let's go through some examples:

As Groucho Marx showed:

Time flies like an arrow.

Fruit flies like a banana.

-

She sells sea shells by the sea shore.

Fortunate, because the brain is mapped, we have a chance of understanding it.

Great individual differences, but similar structures.

- basis of perception

This is our I/O system

when i reach out and touch something

1000s and millions of receptors - particularly in my fingers which have receptive fields.

Signal goes up arm into cortex.

Pay attention, if you bang foot hard. You see it happen immediately and say, \"This is going to hurt.\"

It takes about a second or two then you get wave, \"Wow, this really does hurt.\"

Conduction delay of this wire.

Some are fast. Later - the ones that make you go \"Uuuugh\"

So watch next time you bang your foot.

Reason you go \"Oh man\" when you bang your thumb - [you shake your hand] - the movement sense overwhelms the pain signal. That's why you do it.

- sensory maps

Where signals come from. Mapped out based on way we were evolved to be in relation to the ground.

The so-called sensory humunculis?

On map of US. Same physical relationship

spatial isometry

Parts of brain that allow you to sense the world -

Areas for fingers are far from areas for toes.

Not true representations of true experience, but depend on what you have used.

On physical cortical surface, more surface on fingers, lips and tongue.

System designed for learning - give you a personal evolution.

Can take place over your lifetime.

Nervous system adapts to what you need from it.

If you use your hands a lot, the neurosystem devotes more and more to your hands.

Every ti

Homunculus shows relatively large hands, tongue, and lips, body parts are sized in relation to their number of nerve endings

This is a wiring diagram from several years ago.

It is organized, these are cortical areas, mostly, that produce our experience.

Visual input goes through thalmus, through back of head, and these areas represent very fine details.

Areas here aggregate to create more complex constructs.

If it moves from area to the next -> motion.

Regions like this give us color.

Higher regions extract even more complex features.

Neurons respond to wider areas of space, more complex areas

More conceptually complex kinds of information.

One area responds to faces, perhaps even one particular face.

You are tuning these neurons to have finer and finer perception.

This allows you to have very different experiences.

Pianist at SF Symphony will have a different experience than novice.

If you listen to a language that is not your own,

there are many sounds you simply cannot hear.

That is a process you can learn.

The learning process is greatly accelerated when you are younger.

So, key question: maps and the brain - where is this all going?

Sooner or later, you control actions.

Where will you direct gaze.

Where will you look.

Produces your next input, what you are going to know.

How is it - become output information.

Leading the decision you make.

Where was the YOU in there?

Where, in this processing diagram, was YOU?

- computational network models

Brain is not a neural network model, it is a neural network.

Better and better models, clearer views of how the brain works.

Model brain areas

Inputs go up to more nodes

Will mimic simple or increasingly complex behaviours.

-

Fundamental relation between the two.

Where conscious experience comes from is key.

Where do the decisions get made?

How do you choose muffin vs apple. We have lots of information about it.

Fundamental challenge that we as a species face.

Read book.

- Models for Brain Science.

Rules from vision may apply across to tactile system.

Cell in retina - see light/dark - a receptive field, little spot the cell responds from.

Allows you to form screen - with pixels - dozens of little movie screens in the

back of you head.

One screen - movement

Another screen - colors in my shirt

Abstracting information of the world.

Multiple copies wouldn't help. Why not just have one.

Pull information out and learn how to use it.

Neuron senses brightness in center and surround.

Selecting for a particular kind of information - contrast.

If you line up a bunch of these, you get an edge detector.

Responds to lightness near darkness. The lines of the door.

Abstract shapes.

That's in space. Same principle applies in time.

Constant stimuli don't produce constant experiences

If you get something you love, you'll have habituation.

Take drugs - you'll need more.

Many aspects, starting with single cells - constant stimulus has strong initial response,

over a short period of time response gets smaller.

Think of edge detection - looking for transitions. We need to look for change,

things that are happening.

you become visiually blind to static.

Area you are not looking at can change and you never notice.

What you are \"seeing\" is reconstruction of world. Used by magicians.

- Binary Spike Coding

Binary code.

Single neuron - 5 microns. Stick tiny wire in there.

Stimulus goes from 0 to 1.

Neuron fires discrete, binary outputs.

Continuous signal - no, digital action potentials which propagate on.

Input areas from other neurons.

Typically single output area - decides how many action potentials to fire.

- Hwo do we \"de-code\"

Really exciting

Rate coding / intensity

Spatial coding

overlapping/temportal

So what are the candidates for this code. Despite 1000s of papers.

Rate of 1000s or millions of neurons firing?

Another is WHERE the action takes place. Spatial component relating to fingers.

Overlapped - precise temporal register with one another. Symphony is about relationship of notes, one to another. Time of action potentials to try to code - most obvious in auditory system. Precise temporal qualities - you'll get synchrony.

- Single Unit of Brain

Filled with dye.

Present real challenge to extract information.

May be bouncing while you try to record from it.

Communicate via chemical signal.

channels turn this back to an electrical signal.

All happens incredibly quickly.

Bang hand - milliseconds later you feel it.

Remarkably slow from computational standpoint.

Nervous system uses parallel billions of neurons

Serial computers have only single processor, but much faster.

- Inhibitory and modulatory synaptic transmission

One of the biggest experiences you can have - get things out of whack.

Serotonin will fundamentally transform your experience.

-

-

We often think of high information content signals. Read out entire memories.

Put in computer. Transfer to another person.

Wouldn't that be fantastic .

Something much nearer term.

Lower information density signals.

Trying to understand how read out or written is daunting.

Simpler kinds of information we could read out - just a few bits.

A person's level of pain.

Low dimensionality problem.

Tell from 1 to 16.

Would help to treat that person.

Challenge, much closer to realization.

Not entire experience. Tremendous potential from low infromation density signals.

-

Another important topic: sleep.

Why about 1/3 of our time in this distinct patterns. [Zzzzz]

Other instances where people can do without sleep.

We have only modest hypotheses for what it is for.

-

Peripheral nervous system.

Sympathetic and para-sym: \"rest and digest\"

- One thing everybody knows: 5% use

You only use about 10% of it - urban legend.

Experiment by Lashly in 1950s. Errors made by rats in a maze.

You can lession large parts of brain. Rat still makes it through maze.

Does tell you about redundancey.

Your survival depends on partial injury being survivable.

You can recover lost function.

Adaptability - brain can evolve.

Does not tell you you only use 10% of brain.

Train as athlete. You still use your entire body every day.

- Pioneers

Question: where will we go?

Pioneering effort.

We can lead.

An adventure that fundamentally impacts who we will be

Of great challenges of humankind

experiences

enhanced performance

disease

Get up and stretch. Move around. Then 5 min of questions.

10:16

Q: Dmitry: In mapping, correspondence. What happens?

Can we single out the response of brain region to get feedback for artificial?

Lose limb? Happens a lot in war. Nervous system responds.

Part not getting input.

System tries to adapt itself. Make that hardware useful.

Neural tissue is redeployed - often to adjacent areas.

One unfortunate consequence is phantom limb pain.

Suffering from pain from limb that does not exist.

Debilitating.

Makes people feel like they are going crazy.

Aberant behavior in nervous system.

It turns up gain - so it starts to respond even when there is no stimulus [like feedback in a speaker]

Can the nervous system be trained.

When successful, they can perceive the limb getting smaller and smaller until it goes away.

Second question - how can we listen in through brain interfaces, try to read. Will talk about this in the second talk. Brings together areas I am raising.

Q: Buddhism.

Guys that spend years in caves doing neurotechnology experiments on themselves.

Quite striking results. Change their own experience of life.

My own interest - different perspectives on brain.

As we truly understand, perspectives will come together.

Western/Eastern - in some sense the same?

Perhaps very different. Fascinating for me, not \"one big happy family\" but

how can we learn things from introspective traditions.

How can the introspective traditions learn from Western views.

Q: David A: Consciousness. Van Signal?'s work consciousness rooted in the community.

Community gives shape to consciousness.

Evolving field of social cognition. People realizing neuro- cog sci- not how real world works.

Much ofwhat we do is about building cultures.

We are staring to have powerful insights.

Free will shaped by culture.

Very broad field.

Will be critical area for future work.

We need to understand how we live our lives.

Q: David H: Locations - challenges to growing neural tissue in the lab. Enough cells with enough connections. What more complexity is there?

Very complex topic. Two sides. Technical/Conceptual. Technically, people have been growing single, then groups, neural nets, recording actions. See how these little systems code. Grow pieces. Connect them to computers. Do useful things with them.

More recently, grow small mimics of small pieces of the brain. on the order of a couple of mm.

What are the limits to being able to grow a whole brain.

Use the chemicals to teach the cells where to go and with whom they should connect.

Wire up and precisely place.

We don't know how to reproduce that in the lab.

Connect in the right ways.

Getting better and better. That is the fundamental step.

Conceptually, where are these efforts going. In petri dish and in the computer.

Synthetic models - someday soon of the entire brain.

Which is going to come first - the model or understanding.

If you produce model which runs 100 times faster - what is that model going to be able to do.

If it had no history. Same experience. In what sense is that going to be like a human brain.

Conceptually easier to have model of brain, but not behaviors of real brain.

How can brain evolve to have those behaviors.

Succcess is when they produce complex behaviors.

Tony: Is our sophistication in language tied to thinking? Does using a \"foreign\" language make us less capable?

4 out of 5 scientists don't believe the other scientists.

I'm not going to attempt that one. Cog Sci.

Varies across individuals.

Has had tremendous study.

Yara: Learning slows as we age. Decrease in quality of things learned?

News isn't good.

Good news: used to be childhood plasticity ONLY. No new neurons. Can change quite a bit.

Bad news: ability to learn is dramatically decreased. Language. After early 20s, have accent. Generalizes to many types of learning:

Other distrubing news: get cooking Cog capacity declines with each decade.

IQ

Sensory reception

Plot as normal distribution - if you start above mean today, you will lose a standard deviation each decade (couple decades) from 20's on.

People get better at spotting patterns. They can have judgement that a younger person cannot.

Nervous becomes worse and worse at some skills, but better at specializations.

Take on new kinds of learning.

Keeps your system healthy. Being developed as a technology.

10:37

Presentation you may have seen.

Why to take on this challenge.

One of great challenges.

Go back to prior challenge. Speech that launched previous technological effort.

Very inspiring.

Think about this.

Go within ourselves and change who we are.

[Kennedy Rice Univesity - Sept 12 1962]

\"We choose to go to the moon. We choose to go to the moon in this decade and do the other things, not because they are easy, but because they are hard, because that goal will serve to organize and measure the best of our energies and skills, because that challenge is one that we are willing to accept, one we are unwilling to postpone, and one which we intend to win\"

Led us to leave this planet for the first time to go out. What will it take to go in.

Overcome the challenges that prevent us from changing all aspects of our reality.

This organ produces all our experiences.

If we pioneer our experience there, ...

- Worldwide human disease burden (most affected at top)

Addiction

Anxiety

Obesity

Chronic pain

Depressive Disorders

Sleep Disorders

Hearing loss

attention disorders

alzheimer's

Stroke

Epilepsy

Vision

Schizophrenia & Psychosis

Parkinson's

- Pharmaceutical industry runs in hundreds of billions of dollars to combat these disorders

- Aging Population

- Growth in Neurotechnology patents

- FDA regulatory process

NOT easy

Tremendous challenge.

New drug typically costs $1 bn to bring to market.

Most fail early. Some fail late. $100 m cost.

- Neurodevice markets

Prothetics

Stimulation

Surgery

...

- Interfacing to nervous system

Reading

fMRI [ref]

MEG [ref]

Writing/Stimulation

TMS [ref]

- Cochlear implant

Direct stimulation - 100,000 people can use.

Doesn't always work, but has really changed lives.

- Deep Brain Stimulation

Device like a pacemaker

Tracks to target - about 1 mm in size -

Challenge, if you hit a blood vessel, fatality.

- DBS

Promise for what intervention can do.

Remember, only stimulation. Turns up dial. Low bandwidth signal.

Not complex.

[video: Before: man with twtich. After: much more normal. \"Complete healing\"

Man shaking. Turns off. Becomes normal]

[applause]

Disorders like this could impact 1/3 of you. Especially later in life.

- Vagus Nerve

You can disrupt epilepsy

- Robotic radiosurgery

Automotive robot adapted to brain surgery.

Very precise movement around patient.

Precisely oriented radiation.

-

Navigate precisely in brain.

MRI registred with surgical device.

- Neuroplasticity-based training

Educational software

Rosetta Stone.

Fast ForWord

Brain Age2

PositScience - Reversal of Age-Related Decline

Moving in direction of disease intervention.

Imagine kind of plasticity a serious disease brings to system.

Use own mechanisms to heal.

- INVESTIGATIONAL TECHNOLOGIES

- Transcranial Magnetic Stimulation

Large stimulator through skull.

Done for decades.

Localized stimulation. Useful for activation. Up-regulate areas related to depression.

- Retinal Implant.

Implant pixels to reproduce visual scenes. As done with cochlear implant.

Harder since retina moves around.

Great interest.

On unmoving retina, possible now.

- Brain Computer Interface - Cyberkinetics

Video to read out from brain, control device.

First attempt to directly link from cortex.

[Video: Paralyzed from stab wound. Implant the size of dime.

Playing video game.

Just by thinking.

/watch?v=TJJPbpHoPWo&feature=related

open/close robotic hand]

- Brain-based game controllers?

NeuroSky

Examples you saw were quite simple. Just left/right.

Long way from complex motions.

Dramatic progress for reading out complex information.

Nervous system learns how to use the device.

Give people a new ability and the nervous system can learn how to interface with it.

[using voice recognition is like this too - JG]

Measurements of EMG - scalp muscles - used in game controllers.

/ devoloper tool using eye blink detection

Not high bit rate brain feeds.

- present day nanobot.

- Reversible regional modulation via Ultrasound

Spatially precise

- 690 KHz ultrasound transducer

Just the way you can focus ultrasound probe to scan fetus, you can produce a

tightly focused activation in the brain of -- in this case -- a rodent.

- fMRI-based Brain Reading Today

Quite incredible.

Colleagues at ATR in Japan.

Signals from awake human. Stimuli on screen, read out from visual system what

the visual system saw. Reading the signal out of their mind.

Using sofware to reconstruct what they were experiencing.

They are reading the maps in the back of the head.

Point is - there is a tremendous density.

Different from reading visual mental imagery -

/speakers/yukiyasu-kamitani

/neuron_images_from_brain_using_MRI.jpg

- Real time brain imaging video

Come back to reading low information density content.

Suppose you have debilitating pain.

Probable treatment is a piece of paper - how much pain: mark with pencil 0 to 10

Subjective measure.

What does it mean for my pain to be a 2 versus and 8.

Suppose we could read out objectively.

What if we could read out low density, but very important level of pain.

Depression - how deep is it?

Strong reason to look at low information. Get 5 to 10 bits. Will be transformational.

Are you telling the truth?

What if you could get a reliable answer.

Would not to have judges and juries.

What truth is can be very complex.. But important question:

Imagine you could get that low information density out.

Have you seen this crime scene or not?

Could transform culture.

Q: Bryce/LA: To what extent does finding pain signals depend on empirical or conceptual question. Philosopher of mind perspective.

Many philosophers of the future would agree.

Great lead in. We are trying to read out pain and get people to control it.

Philosophical debate will be outrun by technology.

Elan Vital - now covered by life science.

Let me show you examples coming from Menlo Park.

Do real time brain scanning on yourselves.

- Descartes

Introspection

Imagine looking at the same time at the hardware.

Your experience and objective measurements.

Conduct interaction with patient.

Both therapist and patient could see changes in brain.

fMRI - temporal resolution is a second or two or three.

Spatial resolution is high.

-

-

[video: real time brain imaging]

-

May supplant

couch

pills

knife

-

If you can see these patterns, use mimicry to learn them.

-

[video: read brain in real time - visualization of pain]

Produce or inhibit - can they take control of the dial?

Imagine the kinds of things you could take control of.

Augment your performance.

Reason I use space analogy - we will be able to go into our own minds.

Map onto VR fires.

Try to actually control pain. Takes an end-run around the philosophy.

-RTFMRI Training

Two questions: can they learn to control area of own brain?

Before, couldn't mimic.

Now put on scanner.

Can you or can you cannot?

Answer is: people CAN learn.

Increasing levels - better and better - like brain pushups.

Put these people in pain, asked how much it hurt.

Answer: experience of pain changes in closely corresponding way.

Tried to convince ourselves the patients weren't just telling us what we wanted to hear.

- Can a person learn to mimic complex brain states?

Real inspiration to leave you with. We will be pioneers into journey.

I look forward to sharing that dream with you all.

11:25

Derek: Your fMRI setup. Cost of machines are in millions?

They are.

We hope and anticipate costs will come down dramatically.

A couple decades from now, cheaper.

We are the Mars lander.

Additionally, in coming years, cost is justified given promise of changes you could produce.

About 2/3rds of pain patients never find care. Morphine becomes less and less effective over time and has side effects.

Rand: Symbols. When someone sees an \"N\" do they see the letter?

Experimental answer. Looking at early visual areas. Close to physical stimulus.

Will look like details of what was seen.

That \"N\" looked like a horseshoe.

Higher processing areas, more abstract.

As we read out those more complex areas, what does it mean?

You have to understand the code. What is the meaning of the code?

Code reader becomes more complex.

An \"N\" for an English reader may be different from \"N\" for Arabic reader.

Meaning is transfered through communication.

Transformation has to happen between person whose brain is being read and the perspective of another person.

Q: Chiara: $300 m health issue in US. Society makes problem? Much more worry than in developing country?

Book: Addiction broadly. Human causes. Multifacted causes. Why do cultural influences matter? In the realm of the hungry ghosts.

Eric: Similar perspective. Italian. Leave pain out. Rest, the majority, are side effect of societal development. How much do we want to go downstream, or go upstream and how to avoid them. Mechanisms in modern society cause those diseases? Were they there centuries ago. Too much informatoin. Chemicals circulating.

Really about thinkg down or upstream? Not negating your work on pain.

Fascinating question. Panel on NIH. Deeply rooted in our culture and all cultures - but differentially. Different errors of the system.

Disease pattern varies across culture. Different ratios.

Would raise - how to get best leverage to have positive impacts.

How to most positively impact the most people.

My MO (modus operandi)

Dramatic possibilities to use our understading of the nervous system to impact society.

Example: create simulated versions - virtual worlds - helping people to become better.

Positive influences on person.

Positive role models. Imagine virtual world where all your influences are positive.

could change emotional tone.

Shary: fMRI for resolution. Home use technologies available? DIY way? For depression? concentration?

For home use, limited. Most common by far is EEG.

Senensors on the head. Measure brainwaves.

This training is effective for some things. Not others.

Arousal - Alpha . When you open eyes, you will get different levels.

Sleep - different level.

Broadly, learning to control those. You can do at home with some care.

Relatively tricky. Many measuring muscles, not brain.

Tricky to treat depression.

EEG - ADD/ ADHD work.

Jury still out on depression.

For: are specific enough to learn how to avoid

Against: no signal.

Brain hardward works in mm to cm. While EEG measures \"quadrants\" of brain.

Average over that kind of area, no resolution for control.

Other technologies.

Infrared light shining through skull. Helmet of these. Some spatial organization.

Measure blood flow.

Real problem with hair ... [small chuckle]

Don't see this at low price point any time soon.

Erez: Example of person getting hand smashed and shaking it.

Any approach for stimulating for obesity - just

\"step on the other foot\"

So, there are a variety of ways:

Acute / Chronic.

One kind of stimulus to remove negative aspects of another.

Yes in short term. You can distract yourself. If suffering from pain, and someone yells \"FIRE\" you will not experience much pain on the way out.

Pain turned off in certain situations.

Can turn down response - briefly.

Don't work well long term.

Are treatments based on that.

11:47 [applause]

Interesting Links

Neuroinformatics:/speakers/yukiyasu-kamitani

Chris deCharms TED Talk:/technology2.htm

11:57

Personalized Medicine and the Experimental Man (David Ewing Duncan)

- The Experimental Man Project

Enthusiam still here. Great.

Here to tell you about the future.

I'm not a scientist, expert at neuroscience.

I'm the everyman. Journalist.

Set out to try to figure out lot of what you are learning about - what does it mean for us?

About me.

But about each of us

- ? [huge que question mark]

I want to ask questions. Ready?

- Have you had a genetic test?

At NIH, 250 geneticists - not a single one of them had.

- Have you had a machine read your mind?

- How long do you want to live?

I've asked 10,000s of people.

Three possible choices: 80 / 120 / 150

[[lots want to live to 150]

- Age of Personalized Health

Little clues telling you about your future health.

- Questions to ponder

- How close are we to true personalized HC?

- How can we accelerate the process?

I took all these tests, as a sceptic. I discovered we are far closer to many of these being available.

- How does a

....

....

...

- \"Recreational\" and \"Preliminary\"

Tie to more recent ancestors. As soon as I posted my information, I had a woman call me \"Hey Cousin\"

Bitter Taste gene - pretty harmless, fun test

Intelligence - no test. But ChiChinese are working on it. Taboo for most people ethically.

Gene only predicts 3IQ points.

Herion - 200 people in Germany. Scan genome to see if statistically there are markers.

Such a small group, probably doesn't matter.

Longevity - small group

- Favorite Genetic Marker

If I had a cup of coffee, I'd pause dramatically and sip from it.

- Chemical Report Card

The dose makes the poison.

- Pesticides (DDT)

Grew up in Kansas.

I was exposed to DDT. One of those organo-phosphates. Declining in the environment now.

Each has a half-life.

I still have on board a fairly high level.

One story - once a year they would spray for mosquitos. Big cloud behind cloud.

We would ride our bikes through this cloud.

- Mercury and me

Gets inside us. Always has in small quantities.

Main source now - coal burning power plants -> fish.

Satellite image from China.

Can see a cloud of pollutants coming across the Pacific.

NASA image.

Mercury floating from increase in industry in China.

As this goes across the Pacific, rains on ocean, bioaccumulation in fish.

What happens when I eat large fish?

Caught a halibut and went to market and bought swordfish.

Ate one for lunch, the other for dinner.

Before: 4 parts per billion.

After: 13 ppb. Rather dramatic increase.

-

Did not stop there. In interest in trying to find out what was going on,

did \"Envirogenomics\" screen.

Genetic sensitivity:

Particular codes that suggest you are high risk.

Slightly elevated risk of this Hg gene.

/wiki/Mercury_(element)

- Brain

Kind of spooky the first time you look at your own brain.

Depiction of my brain with the top off.

- Structural MRI

Look at structure to see if it is healthy.

Alzheimers test.

Can detect before symptoms.

Although incredibly expensive, this is the future.

Come up with robust algorithms.

- fMRI

measures blood flow.

View images.

Tested for impulsiveness, risk-taking ...

One guy could tell whether you are Dem or Repub.

Love/Memory

- Fear/Anxiety

Flash lion in front of you.

in fMRI it activates fear.

Shown subliminally.

/wiki/Subliminal_stimuli

- Fear and Axiety

These are the parts of the brain that light up.

- [daisy slide]

This is what my brain did.

Calming effect. Decision making part of your brain has a conversation with the older part of your brain and says, \"Chill out\"

Aside: I have anxiety disorder running through my mother's family.

- My Brain Outs Me

Fun series at NYU on neuroeconomics.

Paul Glimshire?

Stock traders can't account for irrationality.

Stick traders in fMRI - not sure they found much.

I had a clicker. Howmuch I liked product.

Pan's Labarynth movie.

My brain loved Dodgeball movie

Kiterunner second.

Dreamgirls was up there [laughter]

- Consumer Neurology?

Brain Age [ref]

Age 25 (sober) 37 after 2 glasses of wine

Sleep Tests [ref]

electrode. Feeds into laptop. Feeds to their system

- BODY

Finally.

this is where we tie it all together.

Heart Attack.

Intellos [ref]

biosimulation company. Works with pharma.

Mimic body, so you can test drugs without using people.

\"Human body infinitely more complicated than nuclear tests.\"

- Ultrasound. Heart CT.

Compared to real and actualized patients.

Real people who have these same datapoints. Already been through that 20 year period of life.

-

their algo

- Prediction of Future /index.php

This chart, which I kind of believe, shows my heart attack options:

1/ a surprise. My internist said, no attack in family. No one thought 70% in 20 years. Very surprising. Today show was filming. Gotcha moment. I was shocked. Only if I gain half a pound a year. I'm sensitive to weight gain.

2/ gain no weight - 2% risk

3/ zero risk with statins.

I don't have a heart attack. But this does give me rather dramatic results.

Retort: if people were listening, you would not have obese people.

- Future: I-health

One day. Where is my iPhone. We'll be carrying something like this.

July 8, 2015.

Plug in biomonitors. Tracking air.

Halibut sandwich - eat or not?

Go to Giants game - hot dog and a beer? Really high risk. Might do anyway, but risky.

Finally, anxiety disorder. Singularity talk? I have anxiety genes - OK to give talk.

- Mind the Gap

Science needs validating. Largely statistical.

Education needed.

Orwellian issues - living with probabilities

Big brother

Discrimination

No laws for neural data

Obama effect. Shook his hand. His water glass was sitting there. Genotype him?

Expensive

too expensive for most

- Personalized Health Project

Coordinate efforts to validate

Integration is a key

Private sector and early adopters

Encourage (demand?) a paradigm shift

- Coming this fall.

The Linkage Project: A Manifesto

Get leaders to sign. Calling for acceleration bringing technologies to us.

- Still going to more tests

Proteome.

/wiki/Proteome

Bryce: Decentralization of medicine? Or policy shift?

So far behind on applying technology it is ridiculous.

Medicine is conservative.

We have trouble digitizing medical records. UK is 95%.

Obama administration spending there now for cost control.

Manifesto - a natural gap? discovery to application.

Internet 1969, norm 30 years later.

OR, artificial. Lack of focus. Concluded it was the later.

Will come out in October.

Policy level is problem. Discovery level, no problem.

Try to delve a little into implementation - we need as much genius there as in the technology part.

12:49

[applause]

Keith: Next up: 583C in one hour.

=============== DURING-presentation notes

Can't stand the colors of Etherpad? Turn them off with Pad Options.

(Note: this changes the color for EVERYONE.)

Color card definitions:

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Link to backchan.nl for questions:

http://singularity.backchan.nl/meetings/view/147 First speaker

http://singularity.backchan.nl/meetings/view/148 Second speaker

http://singularity.backchan.nl/meetings/view/149 Third speaker

GSP10 Book List:

http://bit.ly/GSP10BookList

=============== POST-presentation notes

Instant Evaluation:

/viewform?formkey=dGVzY3JzR3VFeTJjSElVcjM3REFpY0E6MQ

"

/core-Jul3-EES

"7/3/2010

Saturday

9am-12:30pm

EES CL1 What\"s at Stake and What can be Done?

Gelobter/Hurd

SPEAKERS ON THIS PAD:

9:08 Michel Gelobter

Slides: http://bit.ly/c269Cl

9:41 Gregg Maryniak

Slides: http://bit.ly/dz78nb

10:52 Clint Wilder

Slides: http://bit.ly/bQzngX

11:52 Dr. Steve Schneider

Slides: http://bit.ly/d3vtIZ

9:08 Michel Gelobter

Slides: http://bit.ly/c269Cl

The Power it Takes (problem set): http://bit.ly/bULdsT

SU Spreadsheet The Power it Takes: http://bit.ly/bbRRzI

(all three problems are setup for solving)

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

9:08 Michel Gelobter

Eric: Welcome to third co-chair, Gregg Maryniak.

Gave Peter the book Spirit of St. Louis, triggering whole prize-driven approach.

Has a moonbase named after him.

MG: Indian River/Hudson River stuff?

Friend from Hudson River sitting over on side.

[Slide Motivation]

Energy is largest industry in the world.

Pac Rim alone $200 billion.

$7 trillion between now and 2030. Number we hope will get bigger.

Policy is key.

Major nuclear power plant for processing tar sands. That oil, some of the dirtiest available, will meet CA standards.

It's a very fluid [energy] world, where technology crosses economics and policy.

You need a multi-disciplinary approach.

Solar

Nuclear only will be wrong.

Need a team across disciplines.

Taught undergrads - most important 10 weeks due to Copenhagen, fed policy.

At a critical moment where a variety of things have come together in an unprecedented way.

[Slide: 1942 When you ride ALONE you ride with Hitler!

Bill Maher: 2002 When you ride ALONE you ride with bin Laden]

As Tom Friedman says, when you ride alone you are funding both sides of the war on terror.

The President has been saying lately, \"make no mistake\" [policy is key?]

US uses 25% of global energy. 36% of global green house gases from US.

How do we break down issues?

Analytic and opportunity leverage points you can use.

John Holdren - in 70's.

Four dimensions - The Environmental Cost of Energy

- Insults: exploration, extraction, refining, combustion, disposal.

Change. A hole in the ground. Military events.

- Pathways: air, land, water, visiual, sound, economic, health

Did price go up? Did security risk go up?

Stresses: inhaled toxins, increased atmospheric heat retention

- Costs: from flooding to asthma to increased market risk

Human/economic/social.

How do these things play out.

Analysis map:

Doing exponential impact reports?

Points of intervention. Where can you interrupt the flow?

Block insult?

Interrupt pathway?

Mitigate cost. Maybe induce benefit?

Ways in which human intervention, relative to natural baseline, is having impact:

Methane - 230% more than nature.

Quickest way

24x more potent than CO2

Pollutants from burning.

Except Sulfur, 40 - 70%

Critical one - Lead.

Used 1300% of natural baseline.

Continues in backyards - due to fall out of freeway lead

Pathways/stresses/costs - where to intervene.

Basics of Energy:

KiloJoule - 1000 Joules

m2 kg / s2

Energy is a stockt

Power is a flow, rate at which work is done

Watt: energy/time = 1 joule / sec

The energy system - one of a series of frameworks.

Six places where there are critical variables in the energy mix:

People (P)

Average Income (GDP/P)

Energy Intensity (E/GDP)

Carbon Intensity of Energy (C/E)

=

Carbon Emissions (C)

best known energy company: /. changed from making carpets to becoming a new model for energy effecient floor covering.

Major disruptive change in business model from primary energy production to services industry

Getaround - shift ownership from car to iPhone. Virtualize that. Drive completely different form of service.

Start at end use. Embedded cost.

Replace energy with energyservices - light through window instead of lamp.

Primary power goes into a power station, transmission, lamp, bulb, someone reads a book.

What is delivered to a meter.

Service at end - reading using light from bulb.

Try to intervene at different stages of energy use, think about harvesting issues

Each stage of use is tied to stresses, etc.

How much final energy

China 50% higher intensity (??)

Vietnam 30% more efficient than US. Lots of hydropower.

/wiki/Micro_hydro

You guys can come back and look at these slides.

Harvesting issues.

Primary to end use - spectrum of issues.

Three important things in electricity system

1. Generation

2. Transmission

3. Loads (consumption by users)

Must be balanced.

Can you decentralize?

Once you go beyond 7-8% decentralized, the information needs become overwhelming.

Balance loads.

Millions of loads. Start having 1000s of sources ...

Places you can shunt energy off to increase flexibility.

How do we manage transmission.

Super long distance transmission is a reality today [ref]

How can we manage loads economically.

Costs of Electricity Generation:

Coal is 1/4 to 1/2 of wind

PV is fairly expensive -- dropping for alternatives, rising for fossil fuels.

Key part when economics crosses in is WHEN we use energy.

What times during the year. Due to heat wave coming, we need 45,000 MW in the state

all at once on a hot day.

Those few hours cost 10x more than baseline.

If you could drive down peaks, you could deliver energy a lot more cheaply.

Key story in CA is conservation.

Economic dimensions. 1974 electricity use went flat. Hasn't grown.

Compact flourescent for 3 for $1 [?]

Since 1973, fridge energy use.

Size of refridgerator has gone up, but energy efficiency has returned to 1950 levels.

Cell phones and chargers have take up difference.

5x equivalent use of energy for 50% more people. Still using no more energy than we are today - one solution: conservation.

Answers are, in fact, on the table.

Global analysis. CO2 abatement. McKenzie [ref]

Can eliminate at a profit.

Each place you can graph, study, take one of these bars/technologies and break the cycle around impacts in an exponential way.

\"Well-to-Wheels\"

Couple technologies - using fuel removes Carbon. Cellulosic Ethanol ?

Other very dirty ways ...

Wedges analysis. Key technologies that can be used to intervene.

Another, whole workshop. Dean Kamen.

Gigaton throwdown.

Carbon is a surrogate.

Water/Waste - 70% of problems caused by Energy.

What are promising abatement technologies.

No silver bullet.

Oil/Gas - don't have enough.

500 years of coal, but not enough environmental capacity.

Not enough land for biofuel

Not enough sites for wind/solar and wires to sites

33,000 years of breeder based nuclear

PV too expensive

H is a battery, not a source of energy

Look at review slide

Two views about energy future:

Pessimists

Optimists.

9:41 Gregg Maryniak

How many of you wold like to impact the lives of 1 bn? 10 bn?

A place to do it is in Energy

Probably the most fundamental, catch all commodity that everybody uses.

Gregg Maryniak Slides: /present/view?id=0AXsPlav9xIzoZGZycWc3a2pfMGM3Mzd0Y2Nk&hl=en

10 Grand World Challenges: Energy, water, food, environment, poverty, terrorism & war, disease, education, democracy and population

Dr Steven Chu - the amount of energy we have - it's as if each one of us had 20-30 people working for us all the time

/wiki/Steven_Chu

Energy not equally distributed

For every 1W of energy used, ~$1 of GDP (general trend)

If you want to have population stability, a good way to do that is to make people rich - giving them more access to energy

2 - 3 billion people worldwide currently lack access to modern forms of energy (coal, charcoal, firewood, agricultural residues, dung = primary cooking fuel, 1.6 billion worldwide live without electricity)

First nanotechnology from humanity was soot - kills many people each year

1.Energy

Energy the enabler (Fred Komanoff)

Energy trades for everything

2. Water

Half of hospitalizations across globe because of preventable waterborne disease, barrier is energy, created a vacuum distillation machine

/wiki/Dean_Kamen

People have noted that the American system is set up to covert oil into food

https://publicaffairs.llnl.gov/news/energy/energy.html

One approach is to do something big but do it to someone else

Greg projects need for 10 - 20 x present global energy production

Energy does NOT equal information, much more like water in the way you move it around

Ideal Energy Source Requirements:

Net zero greenhouse gas emissions

No long-term waste storage issues

No land area requirements

No thermal emissions

No local microclimate effects

No external storage requirements

Close match to local load conditions over night and day

Output is easily transportable and storable

Low capital cost

Low operations cost

No reliance on scarce materials for construction and fueling

More people live in cities than outside cities

PC revolution was not a technological revolution.

It was Jobs/ Wozniak's vision just to have fun computer.

Mac cost what a small car cost when it first came out.

Only things you could do was write code and play pong.

Like spending $10,000 today for a video game to play Pong(R).

/wiki/Pong

Assumptions about energy are that earth exists by itself.

We pretend there is no sun.

Using space is a very important part of solution - one of the best.

10:08

Problem sets.

Go in small groups.

10:18

Problem set v1 - all fossil fuel ever formed, 5 days. For far used 1 day.

We can probably only harvest about 30 EJ.

Q: Solar panels are only 15%, we are using just a portion of

Biological processes took millions or years to capture 5 days of sunlight.

Q: How much energy is nature using?

Great question.

Almost none.

Answer to v2 - No, you cannot power that ship with solar power. Largest surface area of anything that moves.

Would need 16,000 W/m2 - about 40x more than actually hits the earth.

Places on equator which are 12,000 W/m2

Concentration of energy - sunlight is very diffuse.

Reason we have been able to power our civilization is because energy is stored.

A mousetrap.

A strobe light.

Changing the time shape of energy.

Just because lots of energy is around, doesn't mean it is in the right form.

Energy you need to move 70,000 tons per mile. Key is conversions, efficiency.

v3 - space problem.

Actually, look at the energy in.

Thermodynamics problem.

Actually use thermodynamics to tell what is the most efficient any system can be.

Put in a lot of thermal systems, max 30% turned to work.

Power plants 40%.

70% is maximum you could get.

You can look for thermodynamic gaps. Move to 60/70. Closer you get, the harder it gets.

Tells you when it is just not possible to get enough energy.

Earth receives 343 W/m2. Energy is conserved. 255 degrees Kelvin - temp of Earth at space boundary.

Get very close to actual Earth values.

Use 1 million times more energy?

Gary/Matt: 19 million degrees?

What you want to figure out is what is main method energy is going to leave.

Will turn into heat. 15m TW or 15 EW or 15 EJ/second. From surface of the earth, 22x more energy than the sun is delivering.

People are thinking about really exponentially greater ways of generating energy. If we went to fusion reactors, created that much energy. Mini suns on the earth.

Replace energy out with 22x energy - solve for T.

Hand waving exercise. Forget the sun.

Solve for energy out and T is 392 degrees Celsius. [HOT!]

What about using 1 million times LESS energy for energy services?

Where is the exponential we want to achieve?

Q: Justin/ Canada. Missing something. Assuming all energy in is heat out?

That is where it ends up.

Justin: When you use energy to build/construct/synthesize anything - energy is stored and not emitted as heat - is it a fair assumption to say that energy in = thermo energy out?

Yes, if we used the energy to build things, yes.

But if we used it to move things, it would become heat.

Q: Eric. 5% growth. We could do much better.

10-20x more energy needed as projection. [for planet]

We could improve efficiency 10 fold.

Much stronger policy than technical issue.

1000s of buildings which consume less than they produce.

Look at slides. I think the whole planet could run on 90% less energy.

Gregg: Some areas where you can make big difference.

This building built in 60's. Energy was \"free\"

Big buildings with giant window surfaces.

Vast areas for efficency improvements.

Permanent magnets.

Large generators are extremely efficient.

You need more energy in your cell phone.

Years ago, systems designed when energy did not matter.

Hopefully as developing world builds out, it won't use old technology.

Coming: Developed world solutions.

Hard core parts of clean tech - hard to make money.

Incumbent competitors.

Disruptive guys are up against world's largest companies.

They will not go quietly.

People working in this area have more courage than I do.

Q: Dmitry. How will dynamic go over next 10-15 years. Peak and decline with drop in PV?

If you can answer that, you can print money for yourself.

Has a lot to do with policy.

If I was emperor of the world, you'd have to pay for clean up of CO2.

When you talk about pricing, that is very hard.

You don't have to pay - so incentive is to use coal in US/Russia

In notes for next week, look at 1956

M. King Hubbert - coal curve

/hubbert/

Jim: Clean tech - biggest % is hydro Won't increase dramatically.

Other than hydro, would need unbelievable exponential increase to have any impact.

People who predict the price of oil/coal/gas believe in linear adoption.

10:39 Break

Steve Schneider. NCAR. Stanford

http://stephenschneider.stanford.edu/

10:52 Clint Wilder

/book/

Clean Tech Revolution on Amazon: http://amzn.to/dr40ZA

10:52 Slides: http://bit.ly/bQzngX

Jim: Now in paperback. In 5 languages.

USA Today, \"One of few books to see Green Tech as economically profitable.\"

Clint: Good morning.

Is anyone here from either Spain or Paraguay? You are forgiven [soccer game]

Thrilled to be in such an international audience.

Been in Europe in May.

Yesterday flying back from NY. Had TV and WiFi. Watching game, on-line with frends in Netherlands. This is a nice next thing to do.

Just a little bit about who I am.

Clean Edge - covers clean tech exclusively. First one. Started in 2000. I joined in '02.

We publish reports, most available free. Clean energy trends 2010.

Job trends report.

Conference in Palm Springs. Next year our 7th, with 500 people.

Cleanedge jobs board.

Can check out job listings.

With Ron, wrote book: Clean tech revolution. Paperback out in Fall '08.

Intention, not just for greenies any more.

Big business.

Not politics or envrinomental view.

About making money.

Thomas A. Edison - invents \"I find out what the world needs, then I proceed to invent\"

Future bounded only by creativity. Especially true in green tech.

Clean tech is :

Harnessing renewable materials and energy sources

Reducing use of non renewable goods

Cutting

with equal or superior performance.

Hybrid car. Still filling it with gas, just a lot less of it. More efficinet, still clean tech.

Cut emissions/waste.

While also offering good service.

Reliable electricity.

Recycled materials.

Qualtiy or people won't buy it.

[Slide: hippy and young businessman = Then and Now]

Live smarter. Emulate nature.

Business is the solution

Feed into the grid (Renewable Energy Finance forum - Wall street [ref])

90% solar power on grid, solar power going mainstream, utilities getting into it.

Small is profitable.

Be interdependent

Think globally and locally, act in both

The people need power - renewable clean power.

Four domains

1/ Energy

2/ Transport

3/ Water (for Q&A) can't live without it.

4/ Materials/Green Buildings (hot area now)

Water

Energy efficient desalination

UV filtration

Reverse osmosis filtration

membranes

Automated Metering and Controls

Water Recovery and Capture

In trends report, track from Big to Huge. $144 bn. Up to $343 bn.

Driving forces - six C's

Costs: volatility vs. steady decline, clean energy costs are declining, fossil fuel costs are volatile

Capital

Competition

China - really kind of symbol of rapidly developing - including Brazil, Russia

Consumer

Climate

Will go quickly here.

Costs: Volatility vs Steady Decline.

Fossil fuel costs goin gup but extremely volatile, hard to predict.

Whereas - wind power or solar. Costs are 0, $ is in the technology to harness it.

Particularly dramatic drops in solar, not as low as we'd like it to be. Steady downward trend.

Capital.

On left, total venture investments. Peaked in 2001 at $40bn.

In energy technology, holding more steady - going up and up (to $2-3 bn). From \x3c1% to 12.5% VC funding in 2009

Competition.

Job creator.

Compeition to get factories, attract entrepreneurs.

Regional reports.

State of MA. WA / OR combined.

All available to public.

China.

Some people say it is a conundrum

Leading in solar

Also in pollution

Consumers

Not just tree huggers and greenies

Compact flourescent and LED lightbulbs

When Walmart is talking green, you know it is mainstream.

Climate

Consensus is beyond challenge.

Key for us: carbon footprint seen as investment risk.

Smart business not waiting for government but moving forward with climate reduction.

Big Eight

Solar

Wind

Sustainable bio

Green building

Autos

Smart grid

Mobile

Water

Solar

Growth in global annual installed solar capacity.

Some Companies: Solar World (German), Trina solar, Qcells (German), Bright Source Energy (US),

First Solar (US - TF solar tech)

.

Wind

Some Companies: Vestas, Repower, GE, Siemens, China Longwan? power group corporation limited, Goldwind

Only 1 is American, GE. All makers of turbines.

Vestas is leader.

Repower is German.

Last one in China is in all power sectors, including solar.

Over last 2-3 years, overseas cos, come to US, mfg here. We have lots of wind but not turbine mfgs.

From Spain,

Shows global nature of industry.

Jim: Goldwind 9-10 bn company. Superconducting magnets to get higher efficiencies.

Close to renewable energy less than Coal.

Google goal: RE \x3c C

Biofuels:

Soybeans and corn

Very resource intensive. Compete with food supply.

Raised prices.

Wrote about this in the book. Good bridge technologies to get to sustainable stocks.

Some Companies: Range Fuels (US), Mascoma (US), Synthetic Genomics (EXXON investment) (US), Aurora Biofuels (US), Sustainable Oils (US), Amyris (BP Investment) (US)

-Range Fuels use Wood waste. Lot of tree not used in products, can be used as biofuel. Fastest growing in the world.

-Macoma, also uses switch grass. They grow like weeds. Cellulosic -

-Synth Gen - Craig Venter

/wiki/Craig_Venter

Algae. Partner with Exxon. $600m / $500 m from BP.

-Aurora Bio. In news, CEO and CFO quit, still announced $15 m funding round the next month. Lot of promise, competition. People chasing this.

High risk.

-Sustainable oil.

Camelina.

Bozeman Montana.

Clean tech has reach.

Green Building sector:

Some Companies: Bright Works (US/China/others), U.S. Green Building Council (fast growing organization), earth advantage (US), Hycrete (US), Gerding Edlen (US)

Wide range of approaches/technologies.

Brightworks out of portland OR.

Leading center for green building expertise.

Work with construction firms/developers.

Low energy and very green.

Over 100 projects completed and working on.

US Green Building council. Fastest growing association of any kind.

Lead standard - leadership in energy and design. Stamp of approval.

Best is Platinum. Gold. Certified. [ref]

First for construction, neighborhoods, single family homes.

Certification program for architects.

Jim: Students interested in efficiency. How can that scale up?

Smart grid sector.

Earth advantage in Portland.

Started under PGE. Spun off. Expanded to CA and MA.

Again they work with both consumers / businesses.

Insulation, HVAC,

Hycrete - building materials.

Cement that uses recycled materials, local sourcing. Help construction people get that LEED certification.

Gerding Edlen

Realestate developers.

Green developments

-

Automobile Electrification.

Tesla IPO.

As you probably read, went up 70% on day when DOW was down 280.

First US auto IPO in 50 years, since Ford Motor.

We write alot about Tesla. A startup car company?? What???

If anyone can do it, Silicon Valley can.

Chevy (Volt)

Nissan also on slide. (Leaf)

Start ups competing with big companies.

Fisker ?

Coming later this year. 15,000 cars in Finland. Investor: Kleiner Perkins.

better place.

Denmark, Canada, ...

battery exchange stations for electric cars.

Instead of gas stations. Very cool concept. Addresses idea you can drive an electric car more than 200 miles if you have this network of stations.

-

Smart grid.

Some Companies: (Silver Spring Networks (US), Enernoc (US), BPL Global, Itron, CISCO (US)

Almost always about more efficient delivery of electricity.

Less waste on transmission.

SilverSpring - in Silicon Valley

Demand response.

BPL. Broadband over Power Lines. In the internet heyday.

Changed now - Better Power Lines.

All about information flow on the power grid.

Knowing when peaks of demand are.

Need information tehcnology experts.

Also CISCO pushing into smart grid.

Information - also including IBM, Microsoft, Google

Jim: CISCO/Intel project in China.

Technology for smart grid.

Itron. Smart meter - largest mfg. Hardware company.

-

Clean-Tech.

Bullish on space.

Lot of growth happening now.

Lots of challenges on resources.

- corn / bio

Policy. Favorable policy in Germany caused great growth.

Fossil price volatility - when these drop, harder for clean energy to compete.

New shale gas in Penn. Could dramatically lower cost of nat gas.

If you are in the wind/solar business, a bad thing.

Private sector credit has not loosened up as much as we'd like.

Project finacne for big wind installations, etc.

NASDAQ indices.

CELS - categories and ETF (Exchange Traded Fund)

Advanced Materials

Energy Intelligence

Energy Storage

Renewable Generation

OMX - wind

QGRD - smart grid, both US and outside US.

\"We are in the midst of one of the greatest shifts in human history\"

Join in shift or become like the dinosaurs.

Sasha: Developing world.

Solar can scale down as well as up.

Thing about solar, wind also. Distributed generation.

One rooftop at a time.

For places getting electricity the first time, can go via \"leapfrog effect\" to build a village, one area at a time.

Developing world has places to grow biofuels.

Jim: Where are nearer term home energy. Obviously solar. Soltions that can work in developing world.

Ericsson - power for cell phones. Didn't come true.

Alaeddine: Space market?

We need to wait a few years whether this is a good market. Sounds far fetched.

We have enough solar here on earth if we deployed it the way we could.

Some ideas - like high altitude wind. Great to push envelop, seek new stuff.

Much better opportunity closer to ground.

/wiki/Masdar_City

Been other efforts in China,other places. Masdar is biggest.

Jim: Was in

/wiki/Tianjin

: Race.

Mney never hurts. Not just the most money. Smart policies.

Entire chapter \"Create your own silicon valley\"

What are the tools ou need.

Coordinate - certain kinds of leadership.

What your region is strong in.

We're going to do clean tech.

Some areas have lots of engineers.

Report on MA - certain things they are not going to do, like big scale mfg.

But they have MIT. And A123 Systems. Energy storage/battery guys. That becomes a core competancy of that region.

Spain another great example.

: Anders/Denmark: Wind power?

That's good point. Wind power industry creates all kinds of other industries around it. 1000s of components. Analyze where wind blows and when.

Guy who goes to big cell phone towers, does analysis of wind with monitor on tower that is already there. Already one big tower, so people won't object to more wind towers.

Supply chain for wind industry

Groth markets: China #1. US continues to be a growth market.

As Denmark matures, more opportunity.

Q: Maggie/ Boston. Interested in MA - Nantucket wind farm controversy. Problem about making wind power more aethetically pleasing. [ref]

Have sense, when they actually put them in, not as bad as everyone feared.

Jim: Big envirnomentalists didn't like idea.

How about a see through wind turbine?

Our friend from Denmark, has offshore wind. Not called ugly.

Article on Cape Cod wind farm, with simulated image from shore

/2009/01/17/us/17wind.html?_r=1

Anders: Vestas has windmill sit next to HQ. Shadow makes you feel turbine is cutting your head off. Offshore is way to go.

Another place - in the Great Lakes. Doesn't have to be an ocean.

Report just done in April.

Q: JulieLynn on behalf of our videographer, Kevin.

Solar panels in windows?

There are projects that combine clean and not-clean energy.

Challenge - intermittent. Energy storage is important.

Combine wind farm with hydro electric.

Small nat gas turbine.

Some green buildings - sky scraper in NY.

Wind turbine coming out of building. Solar on roof. Turbines jut out lower down.

Jim: Thanks. Stay around for lunch.

Clint: Happy to talk to you.

Jim: More right on to next speaker.

11:52 Dr. Steve Schneider.

/

/wiki/Stephen_Schneider

Slides: http://bit.ly/d3vtIZ

Great climate hero of our planet.

Book: Science as a Contact Sport.

/Science-Contact-Sport-Inside-Climate/dp/1426205406

Steve: Thanks Michael.

Enjoying listening to voices from foreign countries - strangest was Texas.

Let me answer part of combining solar with other things question:

Mark Jacobson - student Christine Archer. Can you use solar/wind/renewable as base load? [ref]

Tried to define network: solar thermal - need several hours of storage.

This is system analysis talk.

Systems analysis is not test tube science. No controlled experiments.

Depending on probabilty of risk of brownout. Need 40% oversupply.

Why dump energy? Why not make H, or desalinate.

We could do that. Transition to talk: get out of silo mentalities. Connect systems.

Get out of department's remit. Not stuck in biology dept.

Academia is so siloed. Encourage broad thinking. One reason I agreed to do this.

Appreciated that broad, open minded thinking.

I do media training.

We do a lot of media.

How perceived.

How framed.

People will frame it their way.

Don't use word Singularity on Letterman.

We call them \"Tipping Points\" in public.

We know how important they are, but not where they are.

I want to talk to the problem we have.

Is the science \"settled\" - not kind of word you use in Systems Science.

Last 50 years - warming for 150 - is at least half or more from

AGW - anthropomorphic global warming (don't use this on Today show)

About a year ago I was in New Zealand methane from 60 million sheep

Bottom line was how many believe in global warming, 70% said yes, in Texas is was about 17%

Is the Science \"settled\"?

Can't directly test the future so we test elements of process

Look for multiple emerging lines of evidence

your conclusion is expert when it is subjective

volcano blows off produces dirt in the atmosphere then look at your climate change, does it correlate with global warming trends?

Yes, not proof but does improve probablity of being right

-Well established components

-Competing explanations

-Speculative components

Risk = what can happen x ,,,, (especially in terms of global warming)

what to do about that risk is called risk managment

in looking at risks we can't get the full answer but we can get an idea

risk managment is all the things we can do in policy etc. to mitigate the risks

we are practicing risk management whether we like it or not

if you want to wait until we can prove the results with science then you just made a value judgement and you are no longer a scientist

Soultions have to be corporate, national, and global

You run into policy makers who don't feel the problem is not worth giving up national soveriegnty

Global Warming is going to hell in a handbasket??

Temperature anomally is spiking upward recently

You get issues when people don't understand systems analysis or even sampling error

Bozo senator built an igloo called in \"Al Gore's\" warming house

He is using one day as proof versus decades of climate anomaly data, news covered it as a serious story, \"guilty of scientific child abuse\"

No such good thing as a hockey stick

Good data replicates

Anthropogenic Global Warming AGW

No developing country, enviromental NGO, industrial monolith,

recognize change is transitional

Fracturing of monolith -> deals

Now you 'retro'dict and ask what's a better fit, no matter if it's land, water or air, there is not a perfict fit

using fingerprints of temperature of surface vs. temp of stratosphere

expect to see warmer near humans, we see this but it's not necessarily proof [?]

Mediarology

Mediarology

\"Science as a Contact Sport\"

Not every change is bad, change is change, value judgement on how it affects bad, winners/losers

Change is change, bad if it hurts more than it helps

Environment is not dollarizable, can compare it to tourist industries, that's why this problem is so hard

Non-linear tripping points matter!, energy not T balance, when look at real world, look at multiple factors that determine

Iceland is melting 4 times faster than it's accumulating snow, is this natural and man made causes?

We have nothing to compare it to, like flipping a coin without knowing what a coin is.

Look for other factors in process to look for answer, change prior belief to revised prior (Bayesian)

Change you belief to a revised prior

If this was natural you would see it 20-30 years ago in melt layers but we don't see that

Doesn't prove but we can say it's likey 66-90% that humans are at least half the problem

Everyone loves polarbears but if you try petting one, you'll win the darwin award

How do you dollarize the value of animals that have no GDP but did nothing to cause the problem

Smaller countries say \"you're big and caused the problem and have moeny\" big countries say you have more people and we can't make as big of a diff as you can, both right, Only way to solve this probelm is to make a deal

Help people leapfrog over Victorian Industrial Revolution model

I

Major challenge to democracy

1-5% chance we already can't stop it

We can only do systems analysis or we are experimenting dangerously with the only earth we have which is morally unacceptable

All compitent climate science is global, you can't cherry pick your areas and your time tables, that's why we're not good at the sound bites

Organinzing of IPCC? Imporved and how?

Yes, but how broken is it hard question to answer

IPCC does not do research, it only evaluates what is done

If you are going to have someone comment on a report that actually wrote the report, you have a conflict of interest.

[end of presentation]

Link to backchan.nl:

Morning Session I (09:00 \u2014 10:00)

http://singularity.backchan.nl/meetings/view/127

Morning Session II (10:15 \u2014 11:15)

http://singularity.backchan.nl/meetings/view/128

Morning Session III (11:30 \u2014 12:30)

http://singularity.backchan.nl/meetings/view/129

Instant Evaluation (REMINDER: Visit this link 3 times, once for each EES session):

/gsp10/feedback/week-2

GSP10 Book List:

http://bit.ly/GSP10BookList

"

/core-Jun30-BB

"

Wednesday

6/30/2010

9am - 12pm

Seth Michelson

Biotech

Genomic Medicine, Biotechnology, and Individualized Care

DESCRIPTION: By drafting a consensus sequence of the human genome, medical research has opened an entirely new field of understanding regarding the advent and dynamic evolution of the pathophysiologies we call disease. The technologies developed to accomplish this feat, and then exploit that success to its fullest, are termed Biotechnology, and have spawned an industrial revolution in science and medical research. The next obvious challenge is to exploit that knowledge in a way that will optimize human health. The goal of that effort has been termed Individualized Medicine. Drug discovery and development involve a series of difficult, systematic decision-making exercises, each of which is based on data acquired from a myriad of bioassays, clinical trials, and their incumbent technologies. Only when data describing gene expression, cell function, and whole-body physiology are interpreted in the context of an integrated system function, will we achieve our optimization goals. In this talk, I address each of these aspects in the arena of individualized medicine and describe the relationship between data acquisition, the biotechnologies at hand, and their ultimate application in a \u201cLearn-and-Confirm\u201d model of knowledge acquisition.

Slides: /leaf?id=0ByuGXnC_X6-QOTNlOTFhNWItZDA0OS00OWM3LTkwZDctNjk4MTY2N2RiM2U1&hl=en

Or prezi site: /zd2ibyqy2jik/digitial-biology-biology-under-moores-law/

All Our Ideas: /gsp10bb1

\x3cnotes start here>

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

Agenda

Molecular Biology

- Central Dogma

- DNA replication

- Transcription

- Translation

- Post-Translational Modification

- Proteomic Diversity and Splice Variants

- Reverse Transcription and Viral Infection

Learn and Confirm & Adaptive Trials

- The Sheiner Model

- Time

- Characterizing the heterogeneity space

Biomarkers and signatures

- Observation and Surrogacy

Conclusions

Drug discovery - understanding the biology of the pathway and then creating the drug/molecule to interfere with that pathway

Drug development - once drug is in human.

Appropriate to what we need.

When Raymond first asked me to do this talk, I wanted to make sure we were talking about Human Health.

Biotech is broad: includes agri-science.

I want to talk about biotech for human health and genomics.

Enough to infer cell biogiology.

Homeostatic system.

How to intervene in the most appropriate way.

If you intervene in a human system: that's medicine.

In a personal way: personalized medicine.

Basics: Central Dogma of Molecular Biology

DNA

A flux of information

Moves to actionable item.

DNA => mRNA => Protein (bioactive molecule)

You replace cells all the time.

Half life of red blood cell: between 90 and 120 days.

Over the course of a year, all your blood is new.

Your crip? cells have shorter life. Enable you to digest.

Protein is the actual action figure. That is called translation.

Mutations are both good and bad and it depends on the outcome. They are a measure of adaptability.

Being mutable. DNA must be labile.

Code must be permanetized.

Double door lets HIV in.

CCR5 can be blocked.

People who are homozygous are easier to infect.

People with CCR5 mutation survived while those without would not.

So selective pressure made this feature homogenous in population.

Bad things have died out.

Sickle Cell anemia. This mutation, or phenotype, was a protective agent.

When moved away from malaria, then it no longer becomes protective - became deadly disease for people of African descent.

Mutations are a measure of adaptability.

DNA Polymerase gives RNA, via polymerase, then translated into Ribosome.

So, how does DNA replicate. A double helix. A ladder twisted around itself.

It opens up and replication happens inside of that V.

Perfect Xerox copy right?

[Most of the time]

If not perfect? A clean up enzyme does repairs. Like a zamboni machine (that makes ice smooth at an ice rink).

Once you have DNA and getting something out of it, the information is transfered via MESSENGER RNA. Taking data and information from this guy here to the Polypeptide.

You can translate it into action over here.

DNA vs RNA - deoxyribonucleic acid vs ribonucleic acid - so you lose an Oxygen.

These guys form the sugar backbone of the ladder.

Rungs of ladder built with base pairs (nucleotides).

Adenine - called A.

Cytosine - C

Guanine - G

Thymine - T

On DNA ATCG A+T, C+G they form the rungs.

On RNA, you replace Thymine with Uracil.

Copy complement.

Once you have it, how do you get that information into a protein.

AUGC. How many amino acids could I grab appropriately.

One for each - not enough.

So now I use 2: 16 choices. There are 20 amino acids.

So I use 3: 64 choices, some duplicates.

The nucleotide TRIPLET in mRNA is called a codon.

An encoded chain. Will eventually become a protein.

Can't just run willy-nilly. Must have control

Biological control

Anatomical control

Transcription occurs through mRNA. Sequestered

Proteins you want - some will work in cytoplasm.

You can do more things ... finally make it active.

Though anatomical sequestration, separate where messenger goes. This is the commute. What I spent my time doing in the car this morning.

Make sure things stay where they are supposed to stay.

[Amino acid code table - which triplets code for which of the 20 amino acids]

UUA - Phe

UUC - Leucine

Note there is a STOP. Thank you very much. Go away. Go to work, become an active protein.

Codon saved in DNA, mRNA is actualized.

Okay. Got to build it now. \"I want you to build\"

Ribosome is where action takes place.

Complement ACC grabs Tryp is called TRNA - Transfer RNA.

UUU complements AAA, makes Lysine.

It is an assembly line. You are building a car.

This is not quite the final car. Just a polypeptide change. Giving structure and function.

What does TRNA look like? This is where the appropriate amino acid will bind. A glue to hold them together.

An enzyme comes along and glues it up. One guy on the assembly line puts parts together, then the welder comes along.

You got a gene. You got a protein. That was the old paradigm of thought.

Guess (in betting pool) how many genes C. Elegans had.

We must be more complicated. 150,000 genes? Turns out human animal has 150,000 proteins but only 30,000 genes. Hmmm. That means making 5,6,7 different proteins from codes, so splice variation comes in to loop over DNA to make different proteins.

Gives you multiplicative factor.

You have to be able to do that to handle the diversity.

Very, very complex environment.

Must maintain homeostatis.

Three proteins shown in this cartoon.

So, polypeptide -> protein. Well, not quite. More things to do:

Cleave off things.

Insulin. Get me through this membrane.

Membranes are fatty. Lipo-rich. Need something lipo-philic.

Packaged appropriately, then built, activated through post translation modifications.

Stages of development.

Whole bunch of these - faced by glucose challenge. Rather than whole machinery you have something like INVENTORY.

Good for dynamic environment.

Post translational modification to face diversity.

Everything is hunky-dory (good).

Mutations can be bad. But, we also have viruses to deal with. RNA - reverse transcription.

Copy DNA gets implanted into host. They hijack machinery.

Take over that cell and make more copies of themselves, burst cell open and take over more cells [until caught and stopped by VECOY! - see /Jun29-Vecoy]

RNA will do reverse transcription and hijack your world.

Good artists copy, great artists steal. -- Pablo Picasso

[ref]

Lewis B. Sheiner, 1940-2004

/clpt/journal/v76/n6/full/clpt2004542a.html

What happens in time?

The laws of biochemistry did not change. The rules of statistics did not change. You changed! Where? How? How do I know? What is the impact???

What is the most liver toxic drug you can take?

Acetaminophen (Tylenol)

Biology is speaking to us in the only language it knows. Therefore, we must become fluent in that language. How we caryy on the conversation requires different skills and different tools. We can:

- Listen passively

- Undertake exploratory talks (dose rates)

- Active conversations - hypothesis gneration, bioassays (it isnt the technology but the question that matters!), Clinical trials and others?

Type 1. Error. rejecting a null hypothesis while it's actually true

Type 2. Error. failing to reject an hypothesis while it's not true

Type 3. Error. (joke) getting the absolute right answer to the wrong question

Biomarkers and Signatures

Conclusions (copied from slide):

Molecular biology and genomic medicine are forming a new launching pad to our understanding of human health

To exploit that understanding we must understand our data

And to do that we must embed it in the appropriate physiological context

The context of that context requires we have a conversation with the biology that generated the data in the first place

We can passively observe the systems at hand, conduct exploratory conversations with it or actively query it

The knowledge and insights derived from these conversations will drive the choice of technology we will use

Our insights best accrue from a marriage of inductive and deductive logic and reasoning

The impact of these conversation/technology pairs on human health and individualized medicine span the R&D pipeline

10:05

[Experiment with small group discussions.]

10:20 discussion still going on ... we are 5 minutes into the time for the next session.

10:23 Your attention please - Q&A for Seth. Please put them on the Etherpad.

=========================================================

[QUESTIONS GO HERE]

What is your opinion about direct to consumer advertising? Is personalized medicine dependent on DTCA?

How far away are we from full in silico modeling of a tissue? of an organ?

Erez: How does the~1B$ cost split in the different stages of the drug design process? What are the expess-sinks and how can these be reduced to facilitate faster and cheaper novel drug approval?

Erez: What is the state of the art for glycobiology? can we read carbohydrate trees well? can we artificially manufacture them and add them correctly to proteins? How much is this been dealt with in the biologicals industry?

Erez: are there any serious global alternatives for an FDA drug design approval? a different agency for drug approval which is not an FDA rubber-stamp.

=========================================================

Will continue discussion moving forward.

Core Lectures: Basic biology > Digital Biology > Social Biology > Business trends > What is actionable > What is dangerous > The extremes > The future

Key challenge: Bridging the gap between the exponential increase in biological data and getting useful applications into the real world.

Setting tone for biotech track. The arc of the track. Biology is complicated. Language of biology, mechanisms working.

20% of this class has advanced degrees in biology.

How biology is going digital.

Surpassing Moore's law

Raymond will address this new digital biiology.

Moving beyond digital into social biology.

Business trends - reshaping pharma business, and other opportunities.

Has not been able to accelerate.

What can you do over next 5-10 years.

What is dangerous about these systems. We'll have one of the world experts come and talk about that.

Limits of biology - extremophiles

Where can life exist -50C and +50C. Life is more adaptable than that.

Where is the future?

What we can start to do together this summer.

Share an overview on digital biology

10:28

[applause]

Digital Biology: Biology Under Moore's Law

Slides: [Sarah Russell]

If I get to talking fast or low, just say \"Slow Down\" and \"Speed Up\"

Working now on sequencing.

Senior scientist.

All public information. Speaking just for self.

Originally Biology was like button collecting and badly organized because it lacked predictive theory, A lot evolved recently (last century)

As we got more advanced tools, we discvored more complexity but we were able to simplify our theories.

Think of Biology as Computation.

1's and 0's. Substitutes for some kind of information.

ACGT

Came about when Watson, Crick and Franklin discovered DNA.

/wiki/Dna#History_of_DNA_research

How organized, copied

How biology is NOT like computation

-Limited compartmentalization

-Not that fast, but very parallel

-floppy parts = poor tolerances

-but self-assembling

PCR: invented by Kary Mullis who got the nobel prize for it in Chemistry

/wiki/Kary_Mullis

PCR: /wiki/Polymerase_Chain_Reaction

Allows us to duplicate DNA exponentially, has allowed for an explosion of R&D

Pyrosequencing - measuring the light emitted from modified PCR in order to sequence the DNA

/wiki/Shotgun_sequencing

/wiki/Pyrosequencing

DND Data sequencing has been increased. The Gene bank has been at a standstill with so much data. Private Gene bansk have been set up.

(Slide)

Projects:

Human Genome Project - 2001-2 , ~13 years ~$300M

Celera Genome Project, 2001 ~ 3y

-James Watson Genome

-Illmina Youraban - 2008 - 6 week - 100K

-Illumina Consumer Sequencing - 2009 - 1 week - 48K

-2010 = $9,500-$19,500

Human Genome Sequencing Retail Pricing

June 2009: $48,000

June 2010 $9,500-19,500

Last 3 years we are dropping by a factor of 5

How long until we have a $1 Genome? And what would we do with it?

(from slide)

Sequence EVERYTHING!

\"Look cute...sequence it!\" \"Taste good...sequence it!\" Beijing Inst.

HiSeq 2000

350+ Gb of DNA

2 human genomes

in 5 days

$10,000 each

Feb 200 Gbases - Now 350Gbases

So What?

June 2010: $9,500 - $19,500

Genome-Wide Association Studies (GWAS)

http://grants.nih.gov/grants/gwas/

Used for drug response and disease risk.

Use SNPs (single nucletide polymorphisms) to determine how people differ in their response to drugs

http://www.drugbank.ca/

Plavix drug use

/Index.aspx

Age-related Macular Degeneration

/wiki/Macular_degeneration

Wear sunglasses.

Test: look at graph paper. Are lines \"bendy\"? If so, go see your doctor. [another iPhone app?]

Human disease network. Grouped together - when they share gene or metabolite.

Systems or network biology

/wiki/Systems_biology

Simplified [ha!] view of metabolic pathways.

Even more complexity on top of that.

Number of cells in your body 1 bn you. 9-10 bn that live in your gut/skin. Are you you?

Hope I've blown your mind a bit. Now what I work on.

How are genes put together -

Just genes = just parts list

Epigenetic changes.

copy number variations

10x more variation than SNPs.

On this level - what parts read at any given time and what happens when.

Epigenetics

Epi - means \"above\", literally a code above that of DNA

Methylation

When the \"lollipops\" (methyl group) are on, you get different methylation.

Obesity

Diabetes

If we treat DNA with bisulfite, we can tell wether these things are on or off. The methylated bases turn from C to T, for example, if they are not methylated.

Breast cancer. CPGI Island. You can see at the top the methylation.

Transcriptomics - different splicing in unexpected ways, spanning even into exons(useful code)

Transcript Isoforms - several alternate transcripts. Does anybody know how many genes are alternately spliced? 95% had this. Kind of been driving things for us.

Gene fusion. Causes bad gene to get turned on . Major factor in cancer diagnosis.

microRNA - little pieces land on end of transcripts and turn them off.

Sequence those - regulate 30-40% of all genes.

You are not going to get a single sequence in your lifetime. Sequenced over and over. Good to see prices dropping. Coming into play in medicine and research.

No proteomics now.

/wiki/Proteomics (study of proteins)

Environment and heredity. Genes are not \"Fate map\"

Huge. You want to be able to study and measure to understand.

Future of sequencing - better, faster, cheaper.

Using smaller amounts of reagents.

Used to think there could be no $10,000 sequence.

Fluidime [ref]

Raindance [ref]

Easier: electrically sense DNA. Put though pore. Not an imagining step

Halcyon

Oxford Nanopore

biomimetic

Technologies harnessing biomachines

Automation: have robot do this for you.

Bottleneck is informatics.

Proportion that is chemsitry going down really quickly

Computer power part is going up. So it is an informatics game.

If you've got a Terabyte of data - what is best way to move it?

[FedEx]

Got it in one.

Trends:

Biology is now under Moore's law.

5x for last several years.

Complexity for minimum component cost - well, we beat that.

Sequencing dropping faster than informatics.

Commodity business? racing to bottom?

Better to be USING sequence rather than producing it.

Points on Ray's graph are not the same company year to year.

More opportunities to sell these technnologies

Sequencing is to nanotechnology as RAM is to microtechnology

The End of Science

The Petabyte Age

Biology is personal and getting more so:

DTC Genomics

Navigenics

23andMe

deCodeME

Counsjl

...

Citizen Science

DIY people

- crowd sourced clinical trials. Not profitable for pharma companies.

BioCurious from across the freeway here. Nicest wet tech lab ever seen. [Can we visit?]

Dystopian / Utopian view. But, the dystopian view is ... depressing.

Gene Patenting Problems.

Resolved - Navigenics example.

10% of revenues.

Genetic screening more widely available.

Beyond Batten Disease

NCGR

CureTogether

- open source PCR machine

- $199 gel electrophoresis, plans are free

[end of presentation] 11:20

All Our Ideas crowdsourced questions: /gsp10bb1

Please take 2 minutes to vote for suggestions.

Instant Evaluation:

/gsp10/feedback/week-2

Questions:

Erez: How are we doing with Carbohydrate sequencing? Accuracy? Cost? Speed?

From All Our Ideas:

Tell us about cost and attrition.

What generation of sequencing machines is the HiSeq 2000

Q: How far along are we with DNA tests? Picture ... Commercially available?

How close to portable DNA test attached to phone?

Q: (Rand?) Actually available?

Technology has been proven. doesn't scale well.

Send sample off to lab. 2,4,6 weeks to get results.

Other tests are like blood tests, but expensive.

Q: How far along - iPhone with your informationon it.

Software to display things..

Melanie Swan - wrote apps.

Alumina for full sequence - same thing. How often are you on your iPhone.

Break.

11:23

Link to Next Talk-- Rose, FEE: /core-Jun30-FEE

"

/core-Jul10-EES

"7/10/2010

Saturday

9am - 12pm

EES CL4 Geoengineering Edge Issues:

Sequestration, Geoengineering, Mitigation and Adaption

Dan Whaley/Leinert

Slides: http://bit.ly/bXphT2

EES CL5 Energy for the Developing World

Michael Gelobter

Slides: http://bit.ly/bBCcua

EES CL6 Exponential Technologies

Gregg Maryniak

http://www.tsgc.utexas.edu/tadp/1996/general/maryniak.html

Slides:

Second talk slides:

=============== PRE-presentation notes

Erez has introduced a new SUMMARY Etherpad:

/Pad-One-Liner:o :

Please contribute.

Slide marker in Etherpad:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

[ref]

If you need a reference, use this marker.

PRIOR EES pads:

/core-Jul3-EES

=============== End of PRE-presentation notes

Michael Gelobter

See slides for cumulative emissions of Green House Gases

Before break down of Kyoto protocol,

Only globally

NGOs

Western people advised nations in the pacific

They watch China refuse to allow other coutries put in agression emissions cuts

I like that you have an aggressive target, but the target is unfair. 2.5 green house gas advantage to Germany

Global GDP (slide) in China because of colinization by western powers.

2050-2060 there will be an aggressive population growth in India that equals that before the colonization

Ethical Moral Issues:

Who is responsible historically

Climate Injustice is Rampant within the US & EU

Poor in US > use 30% less

What happens if China comply's with Tibets coal

Two biggest problems:

1. Tragedy of the Commons

/wiki/Tragedy_of_the_commons

Elenor Ostrum wrote about this (won Nobel Prize)

2. Prisoner's Deliemma

/wiki/Prisoner's_dilemma

Price of the resource is directly influenced by the use.

What kinds of policy problems or structures do we have to build to work with the ethical and political issues?

Mitigation: The Grand Tech-Challenges

70% of all environmental problems is caused by energy

In developing world

Common to say that the developing companies don't need to focus on energy consumption

Igores that energy poverty is a universal problem (Kenya walking 7 miles a day to get energy)

The largest human rights -women rights - is tied to energy in the developing world. Women have to walk long distances to fetch firewood for their families.

How do we radically increase energy use in poorer countries.

Example: Cooking:

To make them use the stoves, you make them in the communities.

Understand how stoves are adopted and how long they last, they can actually quantify how much the carbon reductions are and make additional revenue for the families for the stoves.

1/2 the family income is spent on energy

One stove per family doubles family income

Generates good carbon offsets.

Reduces cancer

Stops deforestation

(Amazing little technologies helps in many areas)

Electricity:

Lack of reliable electricity. Major issue as large parts of a big city like Mumbai has electricity about 5-10 hrs a day.

Kenya and India have huge demand for the new technologies like solar power

Two issues:

Centralized and De-Centralized

(see slides)

Water:

Issues of quantity, quality. India has made great progress in water availability and utilization for consumption and agriculture.

20M 3-4 watt agricultural pumps in India alone

A lot of water slavery

Urban Transportation:

Worry about nano buses, not nano cars. Has 70 - 80 cars per 1,000 compared to 800 to 1,000 in the USA.

Energy

Still an issue

Adaptation:

Low elevation coastal zones are expected to be under water in 50 years

Salt water intrusion has lead to wide

Huge available textile industry (moved to Bangladesh) 40% of communities w/textile industries are getting draught.

8 Vat changes a day between two or three different colors, no time to plan or project.

Supply chains are highly innovated for supply, but

70,80,90 percent of water use simply by scheduling your water use.

Surat: 80 cities will face droughts on a regular basis.

50% of Mumbai's treatment is treated every day

Sea Level and changes in altitude is important part of the physics in keeping clean water.

Estimates of 5M global warming refugees predicted for the future. This is mainly because poor people tend to live in areas that get easily flooded.

Advocay in the UN that developed countries should pay their \"guilt\" money in addition to futire payments to compensate for past emmissions.

You can not invent it here and expect it will deployed widely in the developing world. The markets, cultures, and context is different.

Commercial context - Ethical businsee where powerful marketers exist, protectionist

Only 5% of people who need pumps have them

Context is everything.

Example: Sol Griffith's design. (don't know name) replaces gallons of kerasyne with three minutes of biking. Amazing design and very effecients and huge amount of thought.

Didn't sell the technology because many reaons, one way is because the companies that could manf. already liked what they were making.

Could not find a single way to deploy they couldn't find a way to sell it.

Huge advances in information advances, but not in energy.

Adaptation. How do you help companies adapt to climate change.

The reason that you're going into disruptive technologies is because you are changing a country and eventually power dynamics

Do not ignore what you are going to be changing

The Present System is Much Worse than Where We're Headed!!!!

Spending $3 trillion on protecting oil a year - don't ever feel like you're rocking the boat because it's being rocked like crap right now. You have to be humble but you need to be able to point the finger at what the problem is today. When you're fighting incumbents that are a hundred years old, there is a lot to be fighting.

ANDREW **** PRIVATE TALK - DO NOT QUOTE, DISTRIBUTE OR SHARE ***

Department of Energy

Help guide people to energy effeciency,

Significant amount of money being invested in energy efficiency

about $80B went to energy. $36B to clean energy....

Behavior change

Domestic Landscape:

Of $11.5M dollar,s three projects: weatherizing homes.

Weatherization System Program

The Weatherization Assistance Program (WAP) enables low-income families to permanently reduce their energy bills by making their homes more energy efficient.

http://www1.eere.energy.gov/wip/wap.html

doing 110M homes in US, 80B square feet of commerical space

Median home built in 1970's Less effecient than home right now

If you want to touch a lot of homes, not just new homes but retrofit older homes

#1 touching many homes as can

5M dollar program

New engagements with communities in this area - especially areas affected by the economic crisis

State Energy Program $3M to states

Energy Effeciency Conservation

2500 Grantees

Folks on ground trying to put energy effeciency into action

Funding to DOE is removed, so here they work directly with the

Retro

New space trying to explore, best time to be in Energy and Climate in this US history, So much money 16.8B dollars, leadership understands.

Climate, Energy, Economic security all work together, hand and hand. Working with speed, scale and deployment.

Retro Fit Vamp????

DOE to Fund up to $454 Million for Retrofit Ramp-Ups in Energy Efficiency

http://apps1.eere.energy.gov/news/daily.cfm/hp_news_id=202

Pay all upfront cost

Using as a test bed for: new innovative test diagram structures

PACE Financing: Cutting Edge

Right now testing new business models, the energy effeciency model is completely segmented.

Home RetroFit is installing energy effecient measures to reduce energy 20-30%, not many people know about this and its invisible (ceilings, walls). You don't see it. It's invisible.

Investing a lot in education outreach and streamlining entire market. If you want to get a retrofit done, need an energy audit - where are you most innefficient?

Most people don't know what they are spending on energy. In the coming years more people will understand their energy use.

Alison: Are you helping fund smart sensors and systems to understand at a more integrated level?

cont...ANDREW **** PRIVATE TALK - DO NOT QUOTE, DISTRIBUTE OR SHARE ***

We are spending $4-5B on smart sensors, meters. 20M installed in USA now

Market for energy efficiency doesn't really exist. After energy audit, get recommendations but then you need to find contractors for each area - floors, windows, ceilings...

There are hundreds of dollars everywhere (figuratively) in energy efficiencies..

The aim of the DOE is to lower those barriers. Allow the contractors to be able to pick all the $100 all at the same time off the ceiling, walls, insulation etc without having to be specialised in just one area.

This is where to innovate right now, to make it easy for the consumer, right now.

HUGE Implementation problem

Communications: Lots of energy market is home by home. Now working neighborhoods/communities

There are energy savings also in your behaviors

How to develop the programs that change these behaviors?

Communication models are going to be settings up how things are set up not only here but other places on the planet

We don\u2019t yet know how much these technologies are saving.

DARPAe - $450M goes to funding for really immerging stage energy efficieny technologies.

This money isn't going to last. Need private financing. Set up the stage for this to happen

cont...ANDREW **** PRIVATE TALK - DO NOT QUOTE, DISTRIBUTE OR SHARE ***

(EPad died, but here are my notes when it was gone - Alison)

Not happening as fast is the user interaction and behavior changes we are making. We are not rational people, we make irrational decisions, the environments we are in often shape the ways that we make.

Build an environment that would engender energy savings.

Install, energy efficient measures, but still leave lights on and lave windows open, then you loose.

Thinking about behavior change with policies and programs

Very interesting area that is starting to emerge.

A lot of unknowns and uncertainties, money to test this right now and community engagement models.

One of the priorities is not just here, but around the world.

Key negotiation is between USA and other countries is technology

end...ANDREW **** PRIVATE TALK - DO NOT QUOTE, DISTRIBUTE OR SHARE ***

10:23 Break

EES CL4 Geoengineering Edge Issues:

Sequestration, Geoengineering, Mitigation and Adaption

Dan Whaley/Leinert CEO of Climose

Email link to the presentation in our emails. Michio Kaku video, string theorist. Brings math to the Lay Person.

We will be Type 1 organisms in 100 years.

Should humans be in charge of the planet? Should we/could we be the ones responsible for reducing the risk of climate change and stewards of the planet on our path to something greater?

Geoengineering: from civil engineers: lower greenhouse gases or offsetting

Where it fits in the ecosystems

See the Caldeira, 2009 chart example in slides

Can we take C02 and reduce amount released and reduce the amount in the atmosphere, while we get our \"earth house\" in order.

C02 bathtub analagy with tipping point - bathtub

Geoengineering techniques are trying to open drain, build a higher lip, or fill it slower until we find a more long term solution

Options.

Remove greenhouse gases

- biological approaches (requires less energy and

- chemical approaches (more costly less effective)

Reflecting sunlight into space

- space based, putting solar shades pointing back

- stratosphere

- troposphere

- surface

See pictoral representation in slides (Vaughn and Lenton (2009)

\"There is no planet B\" slide.

Geoengineering has been getting attention at the highest level - chiefs of green peace

Does the plan have flaws? (slide 23, location of items on the diagram)

Oft Raised questions: only deploy in an emergency, how do you define emergency?

If we have a geostat, what temperature will we set it to?

Of the 700B tons of CO2 that turn over annually, plankton process about 45%

Marine snow, constant stream of biological matter falling to ocean floor. This creates a current. Turning CO2 into carbonite. This is what has helped cool the planet over millions of years.

Saw tooths in iron correspond to draw down of CO2

When iron is high, ocean is productive.

1993, first project to spread iron sulfate over 5km. Hung around for a week, saw growth of plankton.

Hypotheses are evolving, what would be effect of adding iron to the ocean at the scale of effecting climate change? Will have to do it for a long time... 30% of ocean surface covered, 30-50ppm CO2 reduction. 387ppm now vs 280ppm pre-industrial. Only need to add 1/100th of a drop per 100,000 gallons. $1-5 a ton

Evergreen aviation is a company used for firefighting and may be used to drop the iron into a test project in asia.

Computing power is needed for the complicated mathmatical problems used to understand/evaluate the affects of iron in the ocean on the enviroment.

11:43

We've found planets, Jupiter sized. Nothing like Earth yet.

How do we get the Energy we talked about last week.

How do we get it in abundance without destroying the Earth's biosphere?

Nature gives us some concentrated energy resources.

Predominant sources in the US are fossil fuels.

Unique properties -

Gasoline is a bargain at $5 per gallon.

15x energy content as TNT.

1000x energy density of flashlight batteries.

Fossil fuels are cheap.

Handout slides will be available Monday.

Physics for Future Presidents. (must read book)

Energy Surprises - buy just for that chapter.

Compare coal to AAA battery.

Touch on - real difference between energy running lights and fuel.

Fuel concentrates energy.Chemical fuels have special utility.

More energy into biofuels than you get out -- meaningless. Who cares.

Another reference you will get:

M. King Hubbert. 1956 paper.

Ran into it a few years ago. Amazing how contemporary it is.

US oil production peak in 1970.

Mathematician.

His predictions generally say oil recovery will look like over next 200 years.

Lot of oil left. Have used a little more than half.

We'd rather not use it from a carbon perspective.

But it will be around. Uniquely useful for powering vehicles.

Also did peak production for coal. It runs out in about 700 years.

It is going to be there.

Lot of people in extraction/utilization. Not necessarily evil.

A lot of them very engaged in finding ways to use without harming biosphere.

1956 paper - we live in this tiny slice of time - era of fossil fuels.

From time when we didn't use them, to this time of low hanging fruit,

gave us the power of 20-30 people.

Can we use this to get to the next level?

Energy will be relatively abundant through your lifetimes and your grandchildren.

Will become more expensive.

Cost should consider cost of cleanup - which it does not now.

We are concerned with CO2 emissions.

2% aviation.

People are trying to use climate policy for other purposes. People against airports - discovered no one cares about noise, but people do care about global warming.

US transportation - almost all of that is cars.

If you make cars 100 mpg you dramatically effect that slice.

Home cooking/lighting are really small.

Cars are big thing.

Electricity generation from coal -

Electricity is just a transfer mechanism.

NOT \"My house is powered by electricity\"

My house is powered by coal at 6 cents per kW hour.

Coal is cheap.

EPA - Environmental Protection Agency.

TerraGram - a million metric tons.

A cubic meter of water weighs a metric ton.

A million of those is about 2-3x the US capital.

How much CO2 from all aviation compared to OHare Airport

US output is 50 blocks that size overall.

Flow chart shows \"who is doing what to who\"

Keeling curve - measures of CO2 in HI.

Seasonal teeth in this chart - vegetation absorbs CO2. Northern Hemisphere.

Interesting thing is the decreases - what about planting more plants.

Encourage plant growth in the oceans.

Synthetic diamond trees that will grow on atmospheric CO2.

- Harvesting Carbon from the Air

Algae

Catalytic chemistry and concentrated sunlight. Bind CO2. Sandia/ Battel?

-Two Ways to Reduce Electricity's Carbon Footprint

We live like Kings.

A lot of people - 1/3 - have energy poverty.

One thing you can do is use alternative energy.

Nuclear.

Finland approved just last week.

ISU in Sweden in 1995. Moratorium passed.

Built waste storage facility.

Reversed themselves: better nuclear than carbon.

Getting over their \"religious\" objection to nuclear.

If you look from quantitative perspective, nuclear is a lot more interesting than we might have thought.

If it comes down to feeding or not feeding people, we might consider nuclear.

Not my favorite. But I have one in my backyard.

See David Roberts for micro nukes.

- \"New\" Nuclear

Canada looked into different kind of reactor.

They built CANDU [ref]

/wiki/CANDU_reactor

Interesting thing: can burn nuclear fuel that is much more abundant than Uranium. Uses Thorium. If you burn 5% of Thorium, you could run the planet for 30,000 years at 10x current energy use level.

China looking into this.

Fusion. I'm in my mid-50s. Heard it was just around the corner.

Fusion is the power source of the future - and it always will be.

We are trying to arrange visit to NIF [ref]

Using lots of lasers to implode.

Similar effort in Europe.

Don't know how to do it yet in controlled conditions.

Renewables are appealing. Something for nothing. Energy flowing past us freely.

You may see windmills on way to NIF.

Huge prolifertaion - suffer from intermittancy.

Solar has day/night.

Wind has choatic nature of weather.

Grid issue.

Mismatch between where wind is and transmission.

Here is a nuclear reactor I trust. 4.5 billion years.

\"Sun will explode\"

New sun power. Use heat from the sun to take the place of burning fossil fuels by making steam.

It is just pipes and mirrors - cheap.

To exponentially increase,

Bill Gross of idealab fame are working on

Parabolic collectors.

If lots of hot water, form of energy storage that is not bad.

By the time you have kids your age, available to have things charge themselves if left in sun.

Really cheap solar - like printing newspapers.

Fundamental problem - it is dark half the time.

The Earth gets in the way.

Storage.

We don't have it. Game changer that would make renewables possilbe for baseload power. To the extent it exists, they are in 7 forms:

Lift

- utility scale - we lift water. Thailand to Missouri. Reservoirs on plateaus.

Let run back downhill for peak load supply.

MO pretty flat. But old island.

Big aboveground swimming pool. Doesn't that look like it could leak?

Entire reservior leaked out, wrecked park. Pair of 250 MW turbines.

About 66% efficient. Some as high as 75%.

Very highly efficient turbines.

Motors are already very good.

System like this is very expensive, but if you have these you don't have to build the peak power plant. Peak is most expensive power. Developed world incentives to cut peak power use. Cheaper for them to sell you less.

Spin

- you can rotate something and generate power

[hand held grip-style flashlight ref]

Exact same - look how much longer LED version lasts.

Kinetic storage

LEDs are 90% versus incandescent - 90%heat.

Battery can be employed in that.

Bigger scale. Beacon Power near MIT. Device about the size of two stacked recycling bins. Spins air around. this is in a vacuum envirnoment. Magnetic bearing, very efficient. Only about 6 kW hours. 1 kW is 1000 watts. Two bright lights there would run for 1-3 hours.

So, what do you use it for? Load leveling. Keep grid behaving the way you want.

Helpful if you are running computers, for example.

Could be used for prime storage.

Must be strong. Nanotech - diamond core.

Materials issue.

Heat

a stirling engine.

Hot liquids are easily stored. Thermos. Styrofoam cup. Nano would help here too.

Cold

\"Make hay when the sun shines\"

\"Make ice while the moon shines\" - make ice to cool building

Ancient Iranian trick to make ice in the desert from earth.

\"Cook\"

Chemistry is great way to get storage.

Batteries are less good but effective way.

Car battery weighs 20-30 kilos. Can store energy from motor.

Same as energy in small candy bar.

If you want energy out as electricity, hard to get so small.

If you don't need battery - big tanks of stuff to react reactants. More? Just add more tanks. Look up Vanadium FlowBatteries [ref]

Best batteries are in you laptops. Roll up lithium.

XPrize for electric aircraft - training planes.

To our surprise, this came from China. Everybody can fly.

Lift/drag - 40 knots most efficient.

$15 / hour.

$3 for electricity. Rest amortizing the battery pack. Good for ... then bought back and recycled.

Flying is hard. Enabled by internal combustion engine in early 1900s. Extacting stored energy.

Another mechanism. Two plates - capacitance.

In tech museum store in San Jose: air hogs toys [ref]

Little electric airplanes - recharge in 10 seconds - not battery, capacitor.

People talk about Ultracapacitors. Systems that look more llike batteries than capacitors.

/wiki/Electric_double-layer_capacitor

Capacitors and batteries require surface area. Put more area in small areas. Talk to Ralph Merkle. Nano-tech ultracapacitors.

Batteries - best work in S. Korea. Using nano-tech derived electrodes in batteries.

They exist now.

Squeeze

Compress air. Another mechanical way. Pump gets hot. Boyle's Law.

Usenaturally existing caverns at night when electricity is abundant.

Surprisingly effective.

Not light weight. but that dosn't always matter.

You could fly with it. video - 2 l water bottle launch. About 60m up. Just using compressed air.

Twist

One of the oldest ways. Old fashioned clock. Torsion. Mechanical properties of bending. Torsion powered flying vehicles [lauches rubber band powered balsa plane]

Steve Jervison? - with VC group.

Talking about system that uses reverse osmosis. Run backwards to extract energy.

Big tank of clean water - let it disorganize and get electricity.

/wiki/Osmotic_power

Prelim discussions - appliance?

Why? Don't demand that of anything else except cell phone.

You don't care about mass, except relating to price.

Big rock? so what?

Big storage tank. Issue is cheap.

Trying to keep lights on. Keep vaccines cold.

We pay now. Fossil vs batteries- for mobile cheap power.

Lithum battery - you pay a lot.

Q: Where is peizo electric?

Bend crystal.

Not a power source. Way to convert mechanical energy to electricity.

Micro torsion devices company near MIT.

Bending little tiny fibers.

For those who want to talk more about diffence between kiloWatt and killer Whale can provide 30 minute intro.

Legal and financial reason not to worry about small and light

Furniture not covered by mortgage.

If Big and part of real estate, you can. Not a bad thing to be big and heavy.

If it \"smells\" like a swimming pool, banker might help finance it.

Future Storage

Anti-matter. Combine with matter, you get lots of energy out.

We know how to do that, but only nano-scale. Not nice stuff to have around.

- What to do till suitable storage breakthroughs exist?

- Big networks

Buckminster Fuller dymaxion globe. Solve map makers dilemma of how to make spherical world flat.

Look at this map, as Fuller did, interesting realization.

Draw line through bering straight - build intertie - 35 km.

Global Electric Network Inc (\"genie\") [ref]

Think about that and renewables. Solar cells in the Sahara feeding us in the dark over here.

When I was a college student - \"Let's get off the grid\" evil bad, centralized.

Except, we were wrong Grid is public good Share between haves/have not.

Being off grid trying to run a pump - not much you can do.

What changed hippies was to have electric companies buying back power. It is peak power. So it is agood thing. Meters running in two directions.

That convinced people who were against grid to join it.

Political issues about grids.

Condition where, if you voted against winners, your village didn't get power.

In the long run, we have to get to these transitions.

You live in this Transistion Time.

Ability to get power from your neighbor via networks.

As a result of Bob Metcalf coming, inventor of internet. Thinks we can move energy about the way we move information.

Not much smart gird. Big differences. Grid now is not peer to peer.

Consequently, almost all flows are one way.

Pipes are very different.

Dark fiber - unused capacity.

For electricity, no \"dark grid\" Grid is too skinny.

Not enough capacity to move what we have now.

So, what if we could have benefits of solar power but not unfortunate cyclical power.

Well, we can. Places near earth where sun shines all the time.

Peter Glaser - no matter how hard he worked, he could not get around Earth being in the way.

High Earth Orbit.

His idea - let's collect energy in space. Turn it into radio frequency light. Beam to cities.

Show you demo.

From 1975.

Sent 30 kW of power across between towers.

One had rectennas (receiving antennas)

Half of energy thrown away in resistive loads.

wirelesspowertransmission and goldstone?

50 years of work on this and it works.

No more magical than TV show coming via satellite.

Purpose of sun power is to convey information.

BUT we can send the energy if we want. Just need big structure in space.

Impetus work - just had oil embargo - 1973 scared people in the West very much. Frightening. US almost at peak oil production.

US is 3rd largest producer, but we import 60% of what we use.

US DOE and NASA - 50,000 ton satellites - launched from Earth.

Very bad placeto get things from. Worst place, except sun, for getting materials.

Earth's offshore island - the moon.

Turn picture of solar system so it looks like pool table.

Objects warp gravity.

/watch?v=VBQHtF3WhMw&feature=player_embedded

/watch?v=tcNYJkPgAwg&feature=player_embedded

Gravity wells.

Earth has a nice deep gravity well. But we live near gravity dimple.

One step deep - vs Earth's 22 steps deep.

Push materials over the curve and let it roll down to here.

Space is not part of our home - even though we are surrounded by ocean of materials.

When Neil and Buzz took off from moon - only took top half.

You can get off moon without a rocket.

Anyone own a rocket powered car? boat? Extremely expensive.

you can use mass drivers.

Eric Drexler - Engines of Creation [ref]

/p/06/00/EOC_Cover.html

Maxwell's Equations on his t-shirt = MIT guy.

String of baseball sized objects within a 500 foot launcher.

What is there? O, H3O, ...

We've been there. Had prospectors there.

So close, humans can work on moon without leaving earth.

Round trip 2.7 seconds.

Put in time delay, found people - even old folks adapt in 10 min

Young people take no time. They drive it.

Take 1 min to explore the two planet system you live in.

No biosphere. Good thing.

How far apart should they be?

Need two volunteers. Charles Atlas - you hold up the Earth. [a basketball]

Lost my moon.

Hw close should they be?

Most say 1 m.

2 wraps is geostationary orbit

10 wraps - really 9-1/2.

Part of pay for being here is to show your little brothers and sisters.

1.3 light seconds.

That is your neighborhood.

Distance to sun is 8 minutes.

Little computer board - Arduino.

I've preprogrammed it, it is talking to you in morse code \"SU\"

Program Arduino to delay signal 2.7 seconds.

Rate of switching is 5 words per minute.

Win this XPrize pin.

Basic idea. Plant a seed of activity in space. Feed it with material from moon.

Build solar power satelites. First make copies of system elements.

Bob Friedas's [ref]

Robot in sea of robot parts making copy of itself.NASA has looked at how you might do this on the moon.

Literally exponential growth.

Take only smallest tool set you require. Make copies of your civilization.

Does not require nano.

Can do it with 60's technology.

What if Earth has abundant energy.

Collectors change albedo of earth.

We travel a lot.

Can you do flying without fuel? a light craft. Lasers around for 50 years.

Plane that heats air.

Fuel in 747 is only used to heat air.

You could heat air with laser.

Illustration of one woman space vehicle powered by laser beam coming from space.

Real copies of that exist. Just not that big [ref]

Lasers are now really cheap.

Solid state lasers obey Moore's Law.

Kare, George - banks of lasers on ground to launch.

Nano is great, but you can do this soon to get into Space.

Solar pumps in space.

List of books:

Gerard O'Neill. Giving this to Jose. [ref]

Wonderful.

Solar sails pushed by light photos.

These sails are pushed by radio waves.

- Approaching the Energy Singularity

Moving one 747 from London to New York uses same energy of 1066 England - total.

Limit will be heat.

If everybody had 10-20x. Be careful about combustion products.

Comes down to policy.

If we don't tax for putting carbon in, it won't be cost effective to do these other things.

We need to make the conscious choice to save our planet.

Smaley.

- Energy Gamechagers

Carbon

Harvested Carbon Fuels

\"New\" nuclear

Cost revolution in renewables

Storage

Ultragrid

Power from Space

- [photo of Earth]

Here is what is at stake. Yours and your kids.

Changed from being a lawyer. Not rearranging marbles in a zero sum game.

The sun is too generous to us.

The game is all about energy. Space has a lot to do with it.

Energy has never been so exciting.

Energy basics later.

12:59 [applause]

Q:Dmitry. Exponential decay of laser price? How compared to microwaves?

Will give you Kare's paper.

Cost now is much lower.

Microwaves - radio energy - extremely efficient 83% at received end. Compare to really good solar cells of 20%. Looks like chain link fence laying on the ground.

Energy density is less than sunlight.

Lasers let you start small.

Others need to be big.

For one encampment - can use laser today.

Q:

Key leverage point for accelerating energy singularity.

Great question.

What is big barrier?

Low cost of non-renewable energy.

By using dirty energy without cleaning up. So abundant. Not a good economic incentive to do the investments in the technology. Doing it even though it doesn't pay off yet.

Q: Chiara: ...

Why not Thorium today?

Uranium was low hanging fruit.

Canada had a cheaper kind of Uranium available.

Burning Thorium is new. Inertia. Big companies at lead in US, built different kind of reactor.

Navies built pressurized water reactors.

When you look at it, evey country in the world has Thorium.

1:04 [applause]

Peter had inspiration to do XPrize from book about Lindbergh.

Gregg gave him the book.

At lunch with Gregg:

Ceramic Houses

/wiki/Ceramic_houses

/parameters/pages/ceramic_houses.html

Daniel Yergin, The Prize

/wiki/Daniel_Yergin

/Prize-Epic-Quest-Money-Power/dp/0671799320

Steve Jergeson?

Reverse Osmosis Energy Store

/icrepq'10/631-Salazar.pdf

/wiki/Pressure-retarded_osmosis

Osmotic Power - how does it work?

/energy-sources/osmotic-power/default.aspx

/energy/renewables

Solar plane soars for 24 hours

By Eliane Engeler

The Associated Press

Experimental aircraft collects enough energy in daylight to stay up all night

/printedition/news/20100709/flight09_st.art.htm

2:07 Gregg's presentation continues in 583C:

2:20

- What is WORK.

In old days, had source of energy, had to locate business there.

Water wheels.

- Mechanical Power Transmission

Moved 10s of meters.

- How do we measure rate of energy (power)?

James Watt, inventor of steam engine

One horsepower - in old English system, moving 1 pound object 550 feet.

or a 550 pound object moved 1 foot in 1 second.

- Horsepower relates to cars now.

- One Kilowatt.

A watt is one joule per second.

One joule is lifting an apple up off the table.

One bright incadescent bulb is 100 watts. 10 of those is a kilowatt.

- 1 kilowatt=1.34 horsepower

/wiki/Watt

/wiki/Kilowatt_hour

-

-

-

- Nimitz aircraft carrier

/wiki/Nimitz_class_aircraft_carrier

Has a billion and a half horse power nuclear reactor

- Kilowatt is a rate. For an hour, kW-hour - run 10, 100 Watt lightbulb for an hour

Amazing how cheap you can buy that. One coin from your pocket.

Gary: how many kilowatts in a joule?

/wiki/Joule

Bryce: how many joules per horsepower?

1 joule / second

- Wouldn't it be great if ...

Move mechanical energy to somewhere else.

Enter Benjamin Franklin. My favorite. His sense of humor so bad they would not let him write the Dec of Inde because he would put puns in it.

- Not in my back yard.

\"NIMBY\"

I don't want that powerplant in my back yard.

-BANANA

Build Absolutely Nothing Anywhere Near Anyone

- Three main ways to get electrons moving

1/ Move a magnet near a wire

2/ battery. dissimilar

3/ solar cell - shine light on semiconductor junction Photo voltaics

- other ways

Heat junction - thermocouple. Radio-isotope Thermal Generator - used on all deep space probes.

Squeeze a crystal - piezoelectric - example: gas lighter makes spark.

Q: What kind of experiment left on moon?

That was power source to allow on-going experiments.

Passive laser retro reflector is all that is still working on moon.

-Princeton Piezo heel

Old radios used energy of 80 iPods. Tubes required 20 Watts each.

Marko: Charge wirelessly?

That kind of wireless energy - inductive.

This is not wireless - you'd need wire running up leg.

- Move a coil of wire in a magnetic field.

Take sensitive volt meter, just wave magnet around.

Note that wires here are moving and have contacts. That's a weak point.

Alternatively, Spin magnets instead of wire. That's what you do in your car.

Where do you get energy to turn the crank.

Number 1 way we get energy is heat difference, or waterfall.

- [aerial photo of coal fired power plant on Missouri river]

Power generator in my backyard.

Low sulfur coal.

You can see the big coal pile.

Trains - uni-trains. 120-130 cars, just piles of coal.

2.4 Gigawatts.

Back to the Future.

\"jigga\" or Gig-a-watt

What's the difference between a dead squirrel and a dead accordian player on the road?

It is possible the squirrel was on the way to a paid gig.

- Turning the crank with steam from burning coal.

Source of high temp.

Need also a source of low temperature.

- Turbine in Labadie Power Plant

Looks very much like a jet engine

[roar outside of passing jet]

Right on cue!

These are about 30% efficient converting heat to electrical energy.

70% goes up the stack.

Theoretically, higher.

Secret part of plant is the river. Providing cooling water.

Think of it as a waterfall.

How far does it drop.

In theory, to make it work best, to get perfect Carnot efficiency, the cold side would be at absolute zero.

/wiki/Carnot_efficiency#Efficiency

- Baldwin Lake. 1.7 Gigawatt plant near Sparta, IL.

- US Sources of Elec.

Half coal

20% nuclear

20% nat gas

7% hydro

1.6% oil

Which country has most on a percentage basis? France 70%.

Chicago - gets to 30 below F.

You need power or you die when it is this cold.

Favorite solution - space solar power.

- The Power Grid - Electrical Magic?

- [photo of transmission pylons]

You have losses. Mostly as heat.

Whole grid is designed to minimize those loses.

Change characteristics of power. Change back and distribute to end users.

Like the way gears work.

- Current vs Voltage.

Use a water analogy.

You are familiar with static electricity.

Van de Graaf - high voltage, low current

/wiki/Van_de_Graaff_generator

Current - amp

Pressure of electricity is measured in volts

River, moving slowly, moving lots of water.

High voltage, high current powerline will turn you into charred carbon and smoke.

- Names of Electrical Terms

/wiki/Volt

/wiki/Ampere

/wiki/Watt

- Transformers: Electric gears

Think of magnetic field like blowing up a balloon.

When you make one grow on one coil, it can be taken out

- The Real Transformers

Resistance loss depending on current flow.

Jack up voltage, minimze current.

-

- Grid-a major \"public good\"

This month's National Geographic article. Mostly about future grids.

186,500 miles (300,000 km of grid)

The 21st Century Grid

Can we fix the infrastructure that powers our lives?

By Joel Achenbach

Photograph by Joe McNally

/2010/07/power-grid/achenbach-text

There are times when your electricity may come from 1000 miles away.

- Overview of the Grid

You have to overbuild.

Getting more and more expensive.

- Storage. Not impossible

-

- Taum Sauk Pumped Storage

/wiki/Taum_Sauk_Hydroelectric_Power_Station

- [photos]

Amerind UE

Important asset to them.

Paid a lot of money to fix damage.

- Consequences of lack of storage.

Utilities are not evil. They are owned by rate payers.

Intermittent sources are hard to integrate.

- Full circle - steam kettle to kettle.

How efficient from 1800's device? Very!

This machine wants heat. So you get good results.

- table of things and their power use

Microwave Oven - 1500 watts, but not used for long.

Well pump - 1500 watts.

You can see lights dim in your house when you kick on your hair dryer.

- In houses.

Lighting is 10%

Water heating is pretty large 10%

Cooling of air 17%

Kitchen appliances 29%

People think, \"if i change lightbulbs\"

- In offices

Lighting is 44%.

Buildings - people.

Energy considered free. Big windows. not how you design buildings if energy costs a lot of money.

European hotel - corridor is dark. Infrared sensor turns light on.

No power in room until I put my key in the door.

- New use of electricity.

Moving information. Servers. Big users of electricity.

Spinning drives around? No. Cooling systems.

Some companies who have lots of servers starting to put server farms along Columbia River Valley.

At speed of light, you don't care.

Lots of pipes for information, not so much for electricity.

All servers in the world use about same energy as the Netherlands.

- Light bulb. 19th century device.

You don't care, at the end of the day, until you get the bill.

What gets the job done?

10 % light, 90% heat.

LED is much better.

Cost - capital cost to acquire.

LED is simple in principle, fancy expensive factories to make.

Flourescent vs LED?

/wiki/Fluorescent_lamp

/wiki/LED_light

- Electricity

Some people will never switch, don't have money to make change.

Q: In Europe, cannot buy the old style bulb any more.

US has just passed a law, but no body knows it.

/wiki/Phase-out_of_incandescent_light_bulbs

Energy Independence and Security Act of 2007 ?

The efficiency standards will start with 100-watt bulbs in January 2012 and end with 40-watt bulbs in January 2014.

Big reason people move to cities is to have power.

Rural electrification:

/wiki/Rural_electrification

for light and laundry

Until people saw things made from lunar materials, they would not believe it.

Until people saw \"radio flashlight\" they didn't believe it.

/wiki/Nikola_Tesla

3:31

/curve.htm

/Curve-Binding-Energy-Alarming-Theodore/dp/0374515980

\"Ted Taylor is a theoretical physicist who was for many years a conceptual designer of atomic bombs. At Los Alamos Scientific Laboratory, he conceived and designed the largest-yield fission bomb ever exploded by any nation. Another of his bombs was, in its time, the lightest and smallest ever made.

Taylor later became the leader of a secret scientific effort, financed by the federal government, to make a spaceship the size of a sixteen-story building. The ship was of his invention and was to be called Orion. Powered by two thousand atomic bombs, exploding one at a time, it would move very rapidly to Mars, Jupiter, Saturn, and Pluto. The Limited Nuclear Test Ban Treaty of 1963 ended the project (but if human beings ever achieve travel much beyond the moon, some such vehicle will carry them).\"

Three Gorges Dam

/wiki/Three_Gorges_Dam

Just over 4 solar power satellites.

3:46

Go over books one more time:

2081

/wiki/2081:_A_Hopeful_View_of_the_Human_Future

New Yorker Magazine, Elizabeth Kobert

/reporting/2008/07/07/080707fa_fact_kolbert

A REPORTER AT LARGETHE ISLAND IN THE WINDA Danish community\u2019s victory over carbon emissions.by Elizabeth KolbertJULY 7, 2008

TEXT SIZE:SMALL TEXTMEDIUM TEXTLARGE TEXT

PRINT E-MAIL FEEDS

Once people on Sams\u00f8 started thinking about energy, a local farmer explains, \u201cit became a kind of sport.\u201d Photograph by Joachim Ladefoged.

RELATED LINKSSlide Show: Photographs of the Danish island of Sams\u00f8, by Joachim Ladefoged.

KEYWORDSClimate Change; Global Warming; Sams\u00f8;Denmark; Tranberg, J\u00f8rgen; Energy Reform;2,000-Watt Society

J\u00f8rgen Tranberg is a farmer who lives on the Danish island of Sams\u00f8. He is a beefy man with a mop of brown hair and an unpredictable sense of humor. When I arrived at his house, one gray morning this spring, he was sitting in his kitchen, smoking a cigarette and watching grainy images on a black-and-white TV. The images turned out to be closed-circuit shots from his barn. One of his cows, he told me, was about to give birth, and he was keeping an eye on her. We talked for a few minutes, and then, laughing, he asked me if I wanted to climb his wind turbine. I was pretty sure I didn\u2019t, but I said yes anyway.

We got into Tranberg\u2019s car and bounced along a rutted dirt road. The turbine loomed up in front of us. When we reached it, Tranberg stubbed out his cigarette and opened a small door in the base of the tower. Inside were eight ladders, each about twenty feet tall, attached one above the other. We started up, and were soon huffing. Above the last ladder, there was a trapdoor, which led to a sort of engine room. We scrambled into it, at which point we were standing on top of the generator. Tranberg pressed a button, and the roof slid open to reveal the gray sky and a patchwork of green and brown fields stretching toward the sea. He pressed another button. The rotors, which he had switched off during our climb, started to turn, at first sluggishly and then much more rapidly. It felt as if we were about to take off. I\u2019d like to say the feeling was exhilarating; in fact, I found it sickening. Tranberg looked at me and started to laugh.

Sams\u00f8, which is roughly the size of Nantucket, sits in what\u2019s known as the Kattegat, an arm of the North Sea. The island is bulgy in the south and narrows to a bladelike point in the north, so that on a map it looks a bit like a woman\u2019s torso and a bit like a meat cleaver. It has twenty-two villages that hug the narrow streets; out back are fields where farmers grow potatoes and wheat and strawberries. Thanks to Denmark\u2019s peculiar geography, Sams\u00f8 is smack in the center of the country and, at the same time, in the middle of nowhere.

For the past decade or so, Sams\u00f8 has been the site of an unlikely social movement. When it began, in the late nineteen-nineties, the island\u2019s forty-three hundred inhabitants had what might be described as a conventional attitude toward energy: as long as it continued to arrive, they weren\u2019t much interested in it. Most Samsingers heated their houses with oil, which was brought in on tankers. They used electricity imported from the mainland via cable, much of which was generated by burning coal. As a result, each Samsinger put into the atmosphere, on average, nearly eleven tons of carbon dioxide annually.

*FROM THE ISSUE

*CARTOON BANK

*E-MAIL THIS

Then, quite deliberately, the residents of the island set about changing this. They formed energy co\u00f6peratives and organized seminars on wind power. They removed their furnaces and replaced them with heat pumps. By 2001, fossil-fuel use on Sams\u00f8 had been cut in half. By 2003, instead of importing electricity, the island was exporting it, and by 2005 it was producing from renewable sources more energy than it was using.

The residents of Sams\u00f8 that I spoke to were clearly proud of their accomplishment. All the same, they insisted on their ordinariness. They were, they noted, not wealthy, nor were they especially well educated or idealistic. They weren\u2019t even terribly adventuresome. \u201cWe are a conservative farming community\u201d is how one Samsinger put it. \u201cWe are only normal people,\u201d Tranberg told me. \u201cWe are not some special people.\u201d

his year, the world is expected to burn through some thirty-one billion barrels of oil, six billion tons of coal, and a hundred trillion cubic feet of natural gas. The combustion of these fossil fuels will produce, in aggregate, some four hundred quadrillion B.T.U.s of energy. It will also yield around thirty billion tons of carbon dioxide. Next year, global consumption of fossil fuels is expected to grow by about two per cent, meaning that emissions will rise by more than half a billion tons, and the following year consumption is expected to grow by yet another two per cent.

When carbon dioxide is released into the air, about a third ends up, in relatively short order, in the oceans. (CO2 dissolves in water to form a weak acid; this is the cause of the phenomenon known as \u201cocean acidification.\u201d) A quarter is absorbed by terrestrial ecosystems\u2014no one is quite sure exactly how or where\u2014and the rest remains in the atmosphere. If current trends in emissions continue, then sometime within the next four or five decades the chemistry of the oceans will have been altered to such a degree that many marine organisms\u2014including reef-building corals\u2014will be pushed toward extinction. Meanwhile, atmospheric CO2 levels are projected to reach five hundred and fifty parts per million\u2014twice pre-industrial levels\u2014virtually guaranteeing an eventual global temperature increase of three or more degrees. The consequences of this warming are difficult to predict in detail, but even broad, conservative estimates are terrifying: at least fifteen and possibly as many as thirty per cent of the planet\u2019s plant and animal species will be threatened; sea levels will rise by several feet; yields of crops like wheat and corn will decline significantly in a number of areas where they are now grown as staples; regions that depend on glacial runoff or seasonal snowmelt\u2014currently home to more than a billion people\u2014will face severe water shortages; and what now counts as a hundred-year drought will occur in some parts of the world as frequently as once a decade.

Today, with CO2 levels at three hundred and eighty-five parts per million, the disruptive impacts of climate change are already apparent. The Arctic ice cap, which has shrunk by half since the nineteen-fifties, is melting at an annual rate of twenty-four thousand square miles, meaning that an expanse of ice the size of West Virginia is disappearing each year. Over the past ten years, forests covering a hundred and fifty million acres in the United States and Canada have died from warming-related beetle infestations. It is believed that rising temperatures are contributing to the growing number of international refugees\u2014\u201cClimate change is today one of the main drivers of forced displacement,\u201d the United Nations\u2019 high commissioner for refugees, Ant\u00f3nio Guterres, said recently\u2014and to armed conflict: some experts see a link between the fighting in Darfur, which has claimed as many as three hundred thousand lives, and changes in rainfall patterns in equatorial Africa.

\u201cIf we keep going down this path, the Darfur crisis will be only one crisis among dozens of others,\u201d President Nicolas Sarkozy, of France, told a meeting of world leaders in April. The Secretary-General of the United Nations, Ban Ki-moon, has called climate change \u201cthe defining challenge of our age.\u201d

In the context of this challenge, Sams\u00f8\u2019s accomplishments could be seen as trivial. Certainly, in numerical terms they don\u2019t amount to much: all the island\u2019s avoided emissions of the past ten years are overwhelmed by the CO2 that a single coal-fired power plant will emit in the next three weeks, and China is building new coal-fired plants at the rate of roughly four a month. But it is also in this context that the island\u2019s efforts are most significant. Sams\u00f8 transformed its energy systems in a single decade. Its experience suggests how the carbon problem, as huge as it is, could be dealt with, if we were willing to try.

ams\u00f8 set out to reinvent itself thanks to a series of decisions that it had relatively little to do with. The first was made by the Danish Ministry of Environment and Energy in 1997. The ministry, looking for ways to promote innovation, decided to sponsor a renewable-energy contest. In order to enter, a community had to submit a plan showing how it could wean itself off fossil fuels. An engineer who didn\u2019t actually live on Sams\u00f8 thought the island would make a good candidate. In consultation with Sams\u00f8\u2019s mayor, he drew up a plan and submitted it. When it was announced that Sams\u00f8 had won, the general reaction among residents was puzzlement. \u201cI had to listen twice before I believed it,\u201d one farmer told me.

The brief surge of interest that followed the announcement soon dissipated. Besides its designation as Denmark\u2019s \u201crenewable-energy island,\u201d Sams\u00f8 received basically nothing\u2014no prize money or special tax breaks, or even government assistance. One of the few people on the island to think the project was worth pursuing was S\u00f8ren Hermansen.

Hermansen, who is now forty-nine, is a trim man with close-cropped hair, ruddy cheeks, and dark-blue eyes. He was born on Sams\u00f8 and, save for a few stints away, to travel and go to university, has lived there his entire life. His father was a farmer who grew, among other things, beets and parsley. Hermansen, too, tried his hand at farming\u2014he took over the family\u2019s hundred acres when his father retired\u2014but he discovered he wasn\u2019t suited to it. \u201cI like to talk, and vegetables don\u2019t respond,\u201d he told me. He leased his fields to a neighbor and got a job teaching environmental studies at a local boarding school. Hermansen found the renewable-energy-island concept intriguing. When some federal money was found to fund a single staff position, he became the project\u2019s first employee.

For months, which stretched into years, not much happened. \u201cThere was this conservative hesitating, waiting for the neighbor to do the move,\u201d Hermansen recalled. \u201cI know the community and I know this is what usually happens.\u201d Rather than working against the islanders\u2019 tendency to look to one another, Hermansen tried to work with it.

\u201cOne reason to live here can be social relations,\u201d he said. \u201cThis renewable-energy project could be a new kind of social relation, and we used that.\u201d Whenever there was a meeting to discuss a local issue\u2014any local issue\u2014Hermansen attended and made his pitch. He asked Samsingers to think about what it would be like to work together on something they could all be proud of. Occasionally, he brought free beer along to the discussions. Meanwhile, he began trying to enlist the support of the island\u2019s opinion leaders. \u201cThis is where the hard work starts, convincing the first movers to be active,\u201d he said. Eventually, much as Hermansen had hoped, the social dynamic that had stalled the project began to work in its favor. As more people got involved, that prompted others to do so. After a while, enough Samsingers were participating that participation became the norm.

\u201cPeople on Sams\u00f8 started thinking about energy,\u201d Ingvar J\u00f8rgensen, a farmer who heats his house with solar hot water and a straw-burning furnace, told me. \u201cIt became a kind of sport.\u201d

\u201cIt\u2019s exciting to be a part of this,\u201d Brian Kj\u00e6r, an electrician who installed a small-scale turbine in his back yard, said. Kj\u00e6r\u2019s turbine, which is seventy-two feet tall, generates more current than his family of three can use, and also more than the power lines leading away from his house can handle, so he uses the excess to heat water, which he stores in a tank that he rigged up in his garage. He told me that one day he would like to use the leftover electricity to produce hydrogen, which could potentially run a fuel-cell car.

\u201cS\u00f8ren, he has talked again and again, and slowly it\u2019s spread to a lot of people,\u201d he said.

ince becoming the \u201crenewable energy island,\u201d Sams\u00f8 has increasingly found itself an object of study. Researchers often travel great distances to get there, a fact that is not without its own irony. The day after I arrived, from New York via Copenhagen, a group of professors from the University of Toyama, in Japan, came to look around. They had arranged a tour with Hermansen, and he invited me to tag along. We headed off to meet the group in his electric Citro\u00ebn, which is painted blue with white puffy clouds on the doors. It was a drizzly day, and when we got to the dock the water was choppy. Hermansen commiserated with the Japanese, who had just disembarked from the swaying ferry; then we all boarded a bus.

Our first stop was a hillside with a panoramic view of the island. Several wind turbines exactly like the one I had climbed with Tranberg were whooshing nearby. In the wet and the gray, they were the only things stirring. Off in the distance, the silent fields gave way to the Kattegat, where another group of turbines could be seen, arranged in a soldierly line in the water.

All told, Sams\u00f8 has eleven large land-based turbines. (It has about a dozen additional micro-turbines.) This is a lot of turbines for a relatively small number of people, and the ratio is critical to Sams\u00f8\u2019s success, as is the fact that the wind off the Kattegat blows pretty much continuously; flags on Sams\u00f8, I noticed, do not wave\u2014they stick straight out, as in children\u2019s drawings. Hermansen told us that the land-based turbines are a hundred and fifty feet tall, with rotors that are eighty feet long. Together, they produce some twenty-six million kilowatt-hours a year, which is just about enough to meet all the island\u2019s demands for electricity. (This is true in an arithmetic sense; as a practical matter, Sams\u00f8\u2019s production of electricity and its needs fluctuate, so that sometimes it is feeding power into the grid and sometimes it is drawing power from it.) The offshore turbines, meanwhile, are even taller\u2014a hundred and ninety-five feet high, with rotors that extend a hundred and twenty feet. A single offshore turbine generates roughly eight million kilowatt-hours of electricity a year, which, at Danish rates of energy use, is enough to satisfy the needs of some two thousand homes. The offshore turbines\u2014there are ten of them\u2014were erected to compensate for Sams\u00f8\u2019s continuing use of fossil fuels in its cars, trucks, and ferries. Their combined output, of around eighty million kilowatt-hours a year, provides the energy equivalent of all the gasoline and diesel oil consumed on the island, and then some; in aggregate, Sams\u00f8 generates about ten per cent more power than it consumes.

\u201cWhen we started, in 1997, nobody expected this to happen,\u201d Hermansen told the group. \u201cWhen we talked to local people, they said, Yes, come on, maybe in your dreams.\u201d Each land-based turbine cost the equivalent of eight hundred and fifty thousand dollars. Each offshore turbine cost around three million dollars. Some of Sams\u00f8\u2019s turbines were erected by a single investor, like Tranberg; others were purchased collectively. At least four hundred and fifty island residents own shares in the onshore turbines, and a roughly equal number own shares in those offshore. Shareholders, who also include many non-residents, receive annual dividend checks based on the prevailing price of electricity and how much their turbine has generated.

\u201cIf I\u2019m reduced to being a customer, then if I like something I buy it, and if I don\u2019t like it I don\u2019t buy it,\u201d Hermansen said. \u201cBut I don\u2019t care about the production. We care about the production, because we own the wind turbines. Every time they turn around, it means money in the bank. And, being part of it, we also feel responsible.\u201d Thanks to a policy put in place by Denmark\u2019s government in the late nineteen-nineties, utilities are required to offer ten-year fixed-rate contracts for wind power that they can sell to customers elsewhere. Under the terms of these contracts, a turbine should\u2014barring mishap\u2014repay a shareholder\u2019s initial investment in about eight years.

From the hillside, we headed to the town of Ballen. There we stopped at a red shed-shaped building made out of corrugated metal. Inside, enormous bales of straw were stacked against the walls. Hermansen explained that the building was a district heating plant that had been designed to run on biomass. The bales, each representing the equivalent of fifty gallons of oil, would be fed into a furnace, where water would be heated to a hundred and fifty-eight degrees. This hot water would then be piped underground to two hundred and sixty houses in Ballen and in the neighboring town of Brundby. In this way, the energy of the straw burned at the plant would be transferred to the homes, where it could be used to provide heat and hot water.

Sams\u00f8 has two other district heating plants that burn straw\u2014one in Tranebjerg, the other in Onsbjerg\u2014and also a district plant, in Nordby, that burns wood chips. When we visited the Nordby plant, later that afternoon, it was filled with what looked like mulch. (The place smelled like a potting shed.) Out back was a field covered in rows of solar panels, which provide additional hot water when the sun is shining. Between the rows, sheep with long black faces were munching on the grass. The Japanese researchers pulled out their cameras as the sheep snuffled toward them, expectantly.

Of course, burning straw or wood, like burning fossil fuels, produces CO2. The key distinction is that while fossil fuels release carbon that otherwise would have remained sequestered, biomass releases carbon that would have entered the atmosphere anyway, through decomposition. As long as biomass regrows, the CO2 released in its combustion should be reabsorbed, meaning that the cycle is\u2014or at least can be\u2014carbon neutral. The wood chips used in the Nordby plant come from fallen trees that previously would have been left to rot. The straw for the Ballen-Brundby plant comes mainly from wheat stalks that would previously have been burned in the fields. Together, the biomass heating plants prevent the release of some twenty-seven hundred tons of carbon dioxide a year.

In addition to biomass, Sams\u00f8 is experimenting on a modest scale with biofuels: a handful of farmers have converted their cars and tractors to run on canola oil. We stopped to visit one such farmer, who grows his own seeds, presses his own oil, and feeds the leftover mash to his cows. The farmer couldn\u2019t be located, so Hermansen started up the press himself. He stuck a finger under the spout, then popped it into his mouth. \u201cThe oil is very good,\u201d he announced. \u201cYou can use it in your car, and you can use it on your salad.\u201d

After the tour, I went back with Hermansen to his office, in a building known as the Energiakademi. The academy, which looks like a Bauhaus interpretation of a barn, is covered with photovoltaic cells and insulated with shredded newspapers. It is supposed to serve as a sort of interpretive center, though when I visited, the place was so new that the rooms were mostly empty. Some high-school students were kneeling on the floor, trying to put together a miniature turbine.

I asked Hermansen whether there were any projects that hadn\u2019t worked out. He listed several, including a plan to use natural gas produced from cow manure and an experiment with electric cars that failed when one of the demonstration vehicles spent most of the year in the shop. The biggest disappointment, though, had to do with consumption.

\u201cWe made several programs for energy savings,\u201d he told me. \u201cBut people are acting\u2014what do you call it?\u2014irresponsibly. They behave like monkeys.\u201d For example, families that insulated their homes better also tended to heat more rooms, \u201cso we ended up with zero.\u201d Essentially, he said, energy use on the island has remained constant for the past decade.

I asked why he thought the renewable-energy-island effort had got as far as it did. He said he wasn\u2019t sure, because different people had had different motives for participating. \u201cFrom the very egoistic to the more over-all perspective, I think we had all kinds of reasons.\u201d

Finally, I asked what he thought other communities might take from Sams\u00f8\u2019s experience.

\u201cWe always hear that we should think globally and act locally,\u201d he said. \u201cI understand what that means\u2014I think we as a nation should be part of the global consciousness. But each individual cannot be part of that. So \u2018Think locally, act locally\u2019 is the key message for us.\u201d

\u201cThere\u2019s this wish for showcases,\u201d he added. \u201cWhen we are selected to be the showcase for Denmark, I feel ashamed that Denmark doesn\u2019t produce anything bigger than that. But I feel proud because we are the showcase. So I did my job, and my colleagues did their job, and so did the people of Sams\u00f8.\u201d

round the same time that Sams\u00f8 was designated Denmark\u2019s renewable-energy island, a group of Swiss scientists who were working on similar issues performed a thought experiment. The scientists, all of whom were affiliated with the Swiss Federal Institute of Technology, asked themselves what level of energy use would be sustainable, not just for an island or a small European nation but for the entire world. The answer they came up with\u2014two thousand watts per person\u2014furnished the name for a new project: the 2,000-Watt Society.

\u201cWhat it\u2019s important, I think, to know is that the 2,000-Watt Society is not a program of hard life,\u201d the director of the project, Roland Stulz, told me when I went to speak to him at his office, in the Zurich suburb of D\u00fcbendorf. \u201cIt is not what we call G\u00fcrtel enger schnallen\u201d\u2014belt tightening\u2014\u201cit\u2019s not starving, it\u2019s not having less comfort or fun. It\u2019s a creative approach to the future.\u201d

Stulz, who is sixty-three, is a softspoken man with dark wavy hair and a salt-and-pepper mustache. He was trained as an architect and later became interested in energy-efficient building. In 2001, when he took over the 2,000-Watt Society, his mandate was to push it into the realm of the practical. (His work is funded in part by the Swiss Federal Institute of Technology, which has campuses in Zurich and Lausanne, and in part by private donations.) He began holding meetings that brought researchers together with government officials from cities like Zurich and Basel.

\u201cI divided them into groups,\u201d Stulz recalled. \u201cAnd I told them, At four o\u2019clock each group must come and tell the whole session what project they will do in the future, and who will lead the projects. And they said, Oh, it\u2019s not possible. But at four o\u2019clock everybody came with a project. And that\u2019s how we started.\u201d The cantons of Geneva and Basel-Stadt and the city of Zurich subsequently endorsed the aims of the 2,000-Watt Society, as did the Swiss Federal Department of the Environment, Transport, Energy, and Communications. \u201cAt first glance, the objective of a two-thousand-watt society appears unrealistic,\u201d Moritz Leuenberger, the head of the federal department, has said. \u201cBut the necessary technology already exists.\u201d

One afternoon, Stulz took me to visit the headquarters of an aquatic-research center known as EAWAG, which was designed to meet the 2,000-Watt Society\u2019s energy-efficiency goals. (EAWAG is an acronym for a German name so complicated that even German speakers can\u2019t remember it.) We drove over in his Volvo, which runs on compressed natural gas produced in part from rotting vegetables. When I first caught sight of the place, I thought it was covered with banners; these turned out to be tinted-glass panels. Inside, hanging from a set of chains in a large atrium, was what I took to be a sculpture of a bug. This turned out to be a model of a water molecule, enlarged some ten billion times.

Among the many unusual features of the EAWAG Center is a lack of usual features. The building, which opened in 2006, has no furnace; it is so tightly insulated that, on most days, the warmth thrown off by the office equipment and the two hundred people who work inside is enough to keep it comfortable. Additional heat is provided by the sun\u2014in winter, the outside panels tilt to allow in the maximum amount of light\u2014and by air sucked in from underground. The building also has no conventional air-conditioners: in summer, the panels tilt to provide shade, and if the building gets hot during the day, at night the windows at the top of the atrium open, and the warm air rushes out. It supplies about a third of its own electricity with photovoltaic panels installed on the roof, and gets its hot water from solar collectors. Its bathrooms are equipped with specially designed \u201cno mix\u201d toilets that separate out urine, which contains potentially useful phosphorus and nitrogen. (\u201cExploiting common waste as a resource is a mark of sustainable civilization,\u201d a booklet on the building observes.)

\u201cIt\u2019s not a miracle, such a building,\u201d Stulz told me when we went to have a cup of coffee in the center\u2019s cheerfully modernist cafeteria. \u201cIt\u2019s just putting smart elements together in a smart way.\u201d Outside, it was rainy and forty-three degrees; inside the temperature was a pleasant seventy.

ne way to think about the 2,000-Watt Society is in terms of light bulbs. Let\u2019s say you turn on twenty lamps, each with a hundred-watt bulb. Together, the lamps will draw two thousand watts of power. Left on for a day, they will consume forty-eight kilowatt-hours of energy; left on for a year, they will consume seventeen thousand five hundred and twenty kilowatt-hours. A person living a two-thousand-watt life would consume in all his activities\u2014working, eating, travelling\u2014the same amount of energy as those twenty bulbs, or seventeen thousand five hundred and twenty kilowatt-hours annually.

Most of the people in the world today consume far less than this. The average Bangladeshi, for example, uses only about twenty-six hundred kilowatt-hours a year\u2014this figure includes all forms of energy, from electricity to transportation fuel\u2014which is the equivalent of using roughly three hundred watts continuously. The average Indian uses about eighty-seven hundred kilowatt-hours a year, making India a one-thousand-watt society, while the average Chinese uses about thirteen thousand kilowatt-hours a year, making China a fifteen-hundred-watt society.

Those of us who live in the industrialized world, by contrast, consume far more than two thousand watts. Switzerland, for instance, is a five-thousand-watt society. Most other Western European countries are six-thousand-watt societies; the United States and Canada run at twelve thousand watts. One of the founding principles of the 2,000-Watt Society is that this disparity is in itself unsustainable. \u201cIt\u2019s a basic matter of fairness\u201d is how Stulz put it to me. But increasing energy use in developing countries to match that of industrialized nations would be unacceptable on ecological grounds. Were per-capita demand in the developing world to reach current European levels, global energy consumption would more than double, and were it to rise to the American level, global energy consumption would more than triple. The 2,000-Watt Society gives industrialized countries a target for cutting energy use at the same time that it sets a limit for growth in developing nations.

The last time Switzerland was a two-thousand-watt society was in the early nineteen-sixties. By the end of that decade, energy use had reached three thousand watts, and by the mid-seventies it was up to four thousand watts. This rapid rise could be said to follow from technological advances\u2014the spread of automobiles, the advent of jet travel, the proliferation of appliances and electronic devices\u2014or it could be seen as just the reverse: a failure to apply technology where it is needed. A few years ago, a group of Swiss scientists published a white paper\u2014or, to use the Swiss term, a \u201cwhite book\u201d\u2014on the feasibility of a 2,000-Watt Society. Relying on widely agreed-upon figures, the scientists estimated that two-thirds of all the primary energy consumed in the world today is wasted, mostly in the form of heat that nobody wants or uses. (\u201cPrimary energy\u201d is the energy contained in, say, a lump of coal; \u201cuseful energy\u201d is the light emitted by a bulb once that coal has been burned to produce steam, the steam has been used to run a turbine, and the resulting electricity has been transmitted over the grid to heat the bulb\u2019s filament.) This same paper concluded that, with currently available technologies, buildings could be made eighty per cent more efficient, cars fifty per cent more efficient, and motors twenty-five per cent more efficient.

In Switzerland, I visited several other buildings that, like the EAWAG Center, had been specifically designed to maximize efficiency. One was an upscale apartment building in Basel. The apartments have eighteen-inch-thick walls filled with insulation, triple-paned windows coated with a special reflective film, and a heat-recovery system that captures eighty per cent of the energy normally lost through ventilation. Instead of a boiler, it has a geothermal heat pump, which essentially sucks energy out of the groundwater. In the summer, the same system is used for cooling. (In compliance with Swiss building codes, the building also contains a bomb shelter.)

\u201cThe construction industry is very traditional,\u201d Franco Fregnan, an engineer who showed me around the apartments, said. \u201cIf you bring an innovation to them, you usually have to wait another generation until it arrives into a building. And we are trying to change that, step by step.\u201d

\u201cIt usually makes sense to become more intelligent in any human activity,\u201d Stulz told me. \u201cAs the former Saudi Arabian oil minister Sheikh Yamani once said, the Stone Age didn\u2019t end because there were no more stones. It ended because people became more intelligent. \u201d

hat would it take to lead a two-thousand-watt life? When I posed this question to Stulz, he gave me another research paper, which offers case studies of six fictionalized households. The Jeannerets are an imaginary family of four who live in Glattbrugg, a town north of Zurich. They own an energy-efficient house, travel by electric bike or train, and occasionally rent a car\u2014they belong to a car-sharing service\u2014to do their grocery shopping. The Moeris, fictional farmers who live northeast of Bern, generate their own electricity with natural gas produced from cow manure; and Alain, Michel, Angela, and Marl\u00e8ne, fictional students living in Geneva, share all their appliances, use the tram, and like to go hiking in the French Alps during school breaks. \u201cThere is no formula for how to achieve a two-thousand-watt society,\u201d the paper declares. \u201cThree things are needed: societal decisions. . . technical innovation, and the resolve of every individual to act in an energy-conscious way.\u201d

Very broadly speaking, the average Swiss today uses energy as follows: fifteen hundred watts per day for living and office space (this includes heat and hot water), eleven hundred watts for food and consumer items (the energy that it takes to produce and transport goods is referred to as \u201cembodied\u201d or \u201cgray\u201d energy), six hundred watts for electricity, five hundred watts for automobile travel, two hundred and fifty watts for air travel, and a hundred and fifty watts for public transportation. Each person\u2019s share of Switzerland\u2019s public infrastructure, which includes facilities like water- and sewage-treatment plants, comes to nine hundred watts. Reducing these five thousand watts to two thousand would seem to require a significant reduction in every realm. Assuming that infrastructure-related consumption could be cut to five hundred watts, a person who continued to use fifteen hundred watts for living and office space would have nothing left for food, electricity, and transportation. Similarly, a person who continued to travel and use electricity at current rates would consume two thousand watts without having anywhere to live or work, or anything to eat.

While I was in Switzerland, I kept looking for people who actually led two-thousand-watt lives.

\u201cI\u2019m pretty close, except for this stupid air travel,\u201d Gerhard Schmitt, the vice-president for planning and logistics at the Zurich campus of the Swiss Federal Institute of Technology, told me. \u201cI go once to Shanghai and it\u2019s gone.\u201d (A round-trip flight between Zurich and Shanghai is the equivalent of using something like eight hundred watts continuously for a year.)

\u201cLet\u2019s skip that question,\u201d Stulz said when I put it to him. While he lives in an energy-efficient apartment, he, too, travels a great deal; when I visited, he had just returned from a conference in New Delhi, a round trip that used roughly the equivalent of six hundred watts for the year.

The one person I spoke to who did seem to be leading a two-thousand-watt life, or something very near to it, was an engineer named Robert Uetz. Uetz works in the same building as Stulz, and when we returned from visiting the EAWAG Center he was still in his office, even though it was after six. Stulz encouraged me to go talk to him.

\u201cWe don\u2019t experience it as a restriction,\u201d Uetz told me of his two-thousand-watt life style. \u201cOn the contrary. I don\u2019t feel that we\u2019re giving up anything.\u201d Uetz and his wife, a dentist, live with their two children in the city of Winterthur, near Zurich. About ten years ago, they bought a two-thousand-square-foot house in a newly built energy-efficient development. The house is heated with a geothermal heat pump\u2014\u201cIt\u2019s crazy to heat a house with fossil fuels,\u201d Uetz said\u2014and has a solar hot-water system. Uetz added photovoltaic panels to the roof to produce electricity; in the winter the panels produce somewhat less power than the house uses\u2014it\u2019s equipped with the most energy-efficient lights and appliances the family could find\u2014and in the summer they produce somewhat more, so that over the course of the year the house\u2019s electricity use nets out to zero.

\u201cThe most important decision was that we wouldn\u2019t have a car,\u201d Uetz told me. \u201cThat was a conscious decision. We looked for a house where we didn\u2019t need a car.\u201d Driving a lot\u2014even in what, by today\u2019s standards at least, counts as an energy-efficient vehicle\u2014also makes it difficult to live within two thousand watts. A person who drives a Toyota Prius ten thousand miles a year consumes roughly two hundred and twenty-five gallons of gasoline. This is equivalent to consuming around eight thousand kilowatt-hours, or to using nearly a thousand watts on a continuous basis. (For a family of four, the same gasoline consumption would come to almost two hundred and fifty watts per person.)

\u201cIt\u2019s a matter of what you\u2019re used to, but I find taking the train a lot more pleasant than driving,\u201d Uetz went on. \u201cOn the train I can work and relax. If I took a car, I\u2019d have to worry about parking and traffic, rain, snow, and a certain number of people who can\u2019t drive but are on the road anyway.\u201d When Uetz and his family go on vacation, they travel by rail. \u201cThe only thing I\u2019d say that is sort of a restriction is the flying,\u201d he said. \u201cBecause, obviously, with the train where you can go is limited. We can\u2019t go to China, or if we did it would take a week.\u201d

\u201cI don\u2019t make a religion out of it,\u201d he added. \u201cI wouldn\u2019t do it if I didn\u2019t feel good about it\u2014it\u2019s how I like to live.\u201d

y the 2,000-Watt Society\u2019s own reckoning, cutting consumption is just half\u2014or, perhaps more accurately, a quarter\u2014of what needs to be done. The project\u2019s ultimate goal is a world where people consume no more than two thousand watts apiece and where fifteen hundred of those watts come from carbon-free sources. In such a world, everyone would use energy sparingly, like Robert Uetz, and generate it renewably, like J\u00f8rgen Tranberg. In such a world, filled with windmills and net-zero houses, carbon emissions would fall sharply, and the concentration of CO2 in the atmosphere would slowly level off. But how realistic is such a scenario?

Before I left Switzerland to fly back to New York (a trip equivalent to using roughly two hundred and fifty watts continuously for a year), I went to speak to the president of the research council of the Swiss National Science Foundation, Dieter Imboden. Imboden, who is sixty-four, is a compact man with an oval face and silvery hair. He received his training in theoretical solid-state physics, later became interested in environmental physics, and for several years chaired the Swiss Federal Institute of Technology\u2019s environmental-sciences department. In the late nineties, he served as the director of the 2,000-Watt Society. He said that as a scientist he could see no technical barriers to creating a two-thousand-watt world.

\u201cWe are putting our mental energy into the wrong basket,\u201d he told me. \u201cNothing has to be reinvented\u2014for an engineer it\u2019s not even a challenge.\u201d

\u201cThe problems of the twenty-first century are a different kind of problem,\u201d he went on. \u201cAnd I think our society will be measured according to the solution of this new kind of problem, which cannot be solved with the same recipe as the flight to the moon, or the Manhattan Project. It\u2019s a qualitative difference\u2014a paradigm change in the role of science for our society.\u201d

He continued, \u201cThe difficult thing is what I call \u2018constructed Switzerland.\u2019 You in America could call it \u2018constructed United States\u2019\u2014the buildings and how they are built, but also where they are built and, even more important, the roads, the railroads, the lines for energy, for wastewater, and so on. It\u2019s not economically feasible to replace everything in one instant.\u201d But since infrastructure should in any case be replaced at the rate of roughly two per cent a year, if the project is approached incrementally, it\u2019s a different task. Then, Imboden said, \u201cit suddenly is feasible.\u201d

As of yet, no one has undertaken a rigorous analysis of the economics of a transition to two thousand watts. Researchers have tended, rather, to focus on the price of stabilizing carbon-dioxide levels in the atmosphere at a given concentration\u2014either, say, five hundred and fifty parts per million, which is double pre-industrial levels, or four hundred and fifty parts, which, many climate scientists say, is the very highest level advisable. Perhaps the most often cited economic study is the Stern Review, commissioned by the British government and named for its lead author, Sir Nicholas Stern, formerly the chief economist for the World Bank. The Stern Review, published in October, 2006, concluded that greenhouse-gas levels could be stabilized below double pre-industrial concentrations at a cost to global G.D.P. of around one per cent a year. (The Stern Review considered not just CO2 but other greenhouse gases, like methane and nitrous oxide, as well.) An analysis released last year by the Swedish utility Vattenfall, with research assistance from the American consulting firm McKinsey & Company, reached a similar conclusion: it determined that many measures to reduce carbon emissions, like improving building insulation, would save money, while others, like installing wind turbines, would carry a price. The Vattenfall report estimates that \u201cif all low-cost opportunities are addressed,\u201d CO2 levels could be stabilized at four hundred and fifty parts per million with an annual expenditure of six-tenths of one per cent of global G.D.P.

Though one per cent of the global economy is clearly a lot of money, in the grand scheme of things it\u2019s also clearly manageable. It is about a ninth of what\u2019s currently spent on health care, a seventh of what\u2019s spent on oil, and half of what\u2019s spent on defense. (More than forty per cent of all the world\u2019s military expenditures are made by the United States.) Perhaps most pertinent, it\u2019s a far smaller figure than the cost of inaction. The Stern Review projects that if current emissions trends are allowed to continue, the eventual damage from climate change will \u201cbe equivalent to losing at least 5% of global GDP each year, now and forever,\u201d and that \u201cif a wider range of risks and impacts is taken into account\u201d that figure could \u201crise to 20% of GDP or more.\u201d

Twenty years ago, NASA\u2019s chief climate scientist, James Hansen, testified on Capitol Hill about the dangers of global warming. Just a few days ago, Hansen returned to the Hill to testify again. \u201cNow, as then, frank assessment of scientific data yields conclusions that are shocking to the body politic,\u201d he said. \u201cNow, as then, I can assert that these conclusions have a certainty exceeding ninety-nine per cent. The difference is that now we have used up all slack in the schedule.\u201d Hansen went on to warn that there would be no practical way to prevent \u201cdisastrous\u201d climate change unless the next President and Congress act quickly to curb emissions. Few parts of the U.S. may be as windy as Sams\u00f8, or as well organized as Switzerland, but just about everywhere there are possibilities for generating energy more inventively and using it more intelligently. Realizing these possibilities will require a great deal of effort. We may well decide not to make this effort. Such a choice to put off change, however, will merely drive us toward it. \u2666

Read more: /reporting/2008/07/07/080707fa_fact_kolbert?currentPage=all#ixzz0tK3ZtsDl

=============== DURING-presentation notes

Can't stand the colors of Etherpad? Turn them off with Pad Options.

(Note: this changes the color for EVERYONE.)

Color card definitions:

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Link to backchan.nl for questions:

http://singularity.backchan.nl/meetings/view/157 First speaker

http://singularity.backchan.nl/meetings/view/158 Second speaker

http://singularity.backchan.nl/meetings/view/159 Third speaker

GSP10 Book List:

http://bit.ly/GSP10BookList

=============== POST-presentation notes

Instant Evaluation:

/viewform?formkey=dGVzY3JzR3VFeTJjSElVcjM3REFpY0E6MQ

Reminder: PASSWORD CHANGE on MONDAY 12 JULY.

"

/core-Jul20-EES

"7/20/2010

Tuesday

9 am - 12 pm

EES Session: Edge Issue, Conservation and Efficiency

B583C

9:20 am - 9:40 am: Daniel Kammen (http://kammen.berkeley.edu/ )

Designing a Climate Friendly Future

Slides: http://bit.ly/aNYb7L

9:00 am - 9:20 am: Sunil Paul (/in/sunilpaul )

Slides: http://bit.ly/drkuJw

9:40 am - 10:00 am: Rohit Aggarwala (http://www.worldleaders.columbia.edu/participants/rohit-t-aggarwala )

Slides: http://bit.ly/cWokjE

10:00 am - 10:15 am: Explanation of the wedges/simulation rules and split into 4 groups (corresponding groups A, B, C, D in rooms A, B, C, D)

10:15 am - 10:30 am: Coffee Break

10:30 am - 11:15 am: Groups work in separate rooms

11:15 am - 11:45 am: Groups reconvene in Central Room: Each Group presents

11:45 am - 12:00 m: Final Discussion and Awards Ceremony

Think about the most important variable to scaling key wedges in \u201cwedge analysis\u201d \u2013 how they think about what\u2019s necessary to actually take these to scale. Following the explanations of the rules, students will then break into four groups in Building 583C: the already pre-assigned rooms A, B, C, and D. Sunil, Dan Rohit will rotate among the different rooms and serve as general facilitators. The best teams will win special awards in a closing ceremony.

Three groups (A, B and C) will work for an hour on how exponential technology can ensure that wedges (from GigatonThrowdown Report or otherwise) reach the scale necessary to lighten the global emissions load. These three groups will break out to each address one of the following key wedges:

A. Solar PV (Room A)

B. Building Efficiency (Room B)

C. Biofuels (Room D)

These three groups should spend a small part of their hour checking the core assumptions from GigatonThrowdown (and other sources as appropriate, including other lectures given this summer) of how the particular wedge they\u2019re working on will get to scale. They should spend the majority of their time developing a story of how exponential hard, soft, social, and economic approaches can ensure and/or accelerate the growth of their chosen wedge. (See ) Each group should designate a reporter who will summarize the group\u2019s story back to the plenary group after an hour, and the three workshop leaders will select a winning wedge that will get a special prize.

The other group (D) will go to Room D and engage in an hour-long carbon trading simulation. The winning team in this simulation will also receive a special prize. (See the simple rules of the game below).

_______________________________________________________________________________________________

Info for Groups A, B, C: Wedge Analysis and GigatonThrowdon Summary (read: /files/Gigaton_Overview.pdf)

_______________________________________________________________________________________________

Info for Group D: The Art of a Deal: A Kyoto Protocol Simulation (read: /kyoto_protocol/kyoto_protocol_notes.asp )

In this simulation, you will represent one of several countries attempting to barter an international agreement to lower global carbon dioxide (CO2) emissions. For simplicity, there will only be three countries that need to lower their CO2emissions (Countries A, B, and C). To add a bit of realism, there will be one developing nation (Country D) that is exempt from any reduction agreement.

The goal of each country is to maximize its \u201cscore\u201d as computed below. At the end of the simulation, each member of the highest-scoring country will have their names thrown into a hat for a $50 campus bookstore gift certificate.

Rules

Countries A, B, and C will begin the simulation with 100 CO2 units and $100 per country. Country D has 50CO2 units for sale and $20 to start.

An agreement must be reached that lowers global CO2 emissions of Countries A, B, and C by 100 CO2 units. The 100 could include CO2 purchased from Country D. If an agreement is not reached, no names go in the drawing for the gift certificate.

Countries A, B, and C must approve any agreement unanimously. Country D has no vote.

Each country will designate two representatives that may speak to any other country or address the countries as a whole.

Country D has 50 CO2 units available for sale. Any country can purchase these units with their dollars. These 50 units can be sold in smaller blocks to separate countries. Any money used to purchase CO2 units is given directly to Country D.Any CO2 unit sales or reductions must be done in whole units.

Scoring: Determining the Winner

Countries A, B, and C

At the beginning of the simulation, Countries A, B, and C all have 200 points ($100 + 100 CO2 units). However, at the end of the simulation if the CO2 units of A, B, or C are below 100, their economies suffer. If the CO2 emissions are below 100, the economy must go down by one-half the amount below 100 units. For example, if Country A ends up with 80 CO2 units and $100, their economy will end up at $90. Their total score will then be 170.

Country D

The final score will be three times the economic size in dollars. Your starting economy size is $20, for a starting score of 60. No credit will be given for unsold CO2 units.

Notes from video

/video/

7:20 2 million more direct jobs from clean energy

7:44 To stabilize climate, we've got to reduce carbon by 5-7 gigatons per year

9:10 All fossil fuel use is a threat to our national security

9:50 Biggest impact is through fuels - cellulosic ethanol

11:51 Over the next 10 years, $13 T will be invested in fossil fuels worldwide

12:31 Three things needed

Capital - waiting

Technology - capable of scaling

Policy - remaining open question

13:10 Rules of the game are designed for the fossil fuel industry

13:50 Key is to have stable policy

14:10 Being subject to politics is \"death\"

14:50 [slide showing 93% / 73% / 77% annual drops in wind turbine demand as production tax credits expired in 2000 / 2002 / 2004] This has led to bankruptcy of every wind company in the US.

9:15 Jose: Final day of Phase I

Three speakers this morning.

Dan Kammen from Berkeley.

Designing a Climate Friendly Future

Daniel M. Kammen

Slides: http://bit.ly/aNYb7L

Dan: Thank you.

We have a heavy agenda.

Workshop part of this will be designing a clean, low carbon solution.

The world's largest problem.

We have an hour.

Among the policies, technolgies, investment areas

design a coherent plan.

To put limited resources and huge amount of needs in perspective.

Steve Schneider passed away.

Important about him - very rare. Academics don't normally take their research results and jump into the public battle.

Spoke the truth.

The number of public officials who speak the truth - is rare.

Two aspects:

The data - Amory Lovins used to say, \"In God we trust, all others bring data\"

Steve highlighted what the data say.

Just to highlight - dramatic retreat of ice in Himalayas.

Incredible loss of ice in Rockies, Andes.

In 2009, spring arrives a week earlier and fall ends a week later.

Dramatic change for all kinds of animal species.

People look at the model results.

Find simple, clear ways to say what is going on.

99.9% of climate scientists agree on the data.

Yet 50% of people ... leave the train. Don't believe the human causes.

\"Climate-gate\"

Real failure to communicate the data.

June is the warmest in human history.

Who did NOT see that result? [most]

What I will show you is the amount of sea ice at the summer minimum.

There will be noise in the record.

Snapshot.

1 million square km.

Two things going on in this record.

Model free assessment of where we are today.

Even if one data point is dramatically important.

Linear trend - 50% loss in sea ice.

Both this linear trend with noise, hint

the thing that climate scientists suspect

we know there are surprises lurking for us as the world warms.

Hard to tell the story of the absolute calamities coming

Goal. Devise a climate plan.

History of US GHG emissions.

US is 1/4. China 1/4.

GHG in billions of tons on this graph.

Missed Kyoto goal - no comment.

For all bad press of IPCC for Climategate.

Done relative to 1990 baseline - 20% reduction from today. Then 80% from there.

De-carbonize the entire economy in 40 years.

We know how to get here.

We do not know how to do this [drop to 2050]

Full path is not yet discovered.

Copenhagen - 25-40% below 1990.

CA goal, get back to 1990 level.

Bills in US, mid-term goals.

Client science is very clear.

Snow in N hemisphere.

Series of IPCC reports - first: might take a decade to get clear data, second balance of data, third most data, fourth significant risk - warming will impact global poor.

So that is supposed to depress you all.

We do have successes. Look at kWh/person.

Dramatic decoupling that contributed to CA.

Today CA is about 40% better than national avg.

NY, RI, Wisconsin have done above national avg.

Denmark is 40% better than CA.

Efficient use of waste materials.

kWh / person - while, per capita looks great, added a lot of capitas.

San Fran - all incandescent lighting.

Sunil will talk about the economics.

Hard to replace a brown electron with a green electron if there is not better quality service along with it.

Going green doesn't just get you brownie points in heaven, it saves you money or gives you better service.

Lurking problems in the greenhouse. Any Canadians? From Alberta? They have bitumen.

Used to be called tar sands. Now called oil sands.

These are the piles of waste sulfur.

Venezuela.

More oil in Alberta than in Saudi Arabia.

Takes about 30% of energy, natural gas bubbled through soil. venting H to atmosphere.

to get oil

So we pass through two cleaner fuels to get oil.

Gigaton Throwdown

Building another nuclear sector.

Thinking about how to grow these.

Solar - 1990 assessments. Large fields, distributed homes, off-grid. Made estimates.

200 absolute solar enthusiasts - this what we forecast. This is what happened [much higher growth]

We thought least cost $/W.

Kenya - as % of pop. - only 10-12 W. but small distributed systems at high cost grew much more quickly than central ones.

Now seeing German, Portugal, Ontario - large scale.

Experts can be dead wrong.

May be able to come up with interesting new ways - because we had our heads up ... something.

- Public R&D.

Manhattan

Apollo

Reagan Defence

Jose: Star Wars

War on Terror

6-7x increase in short term.

My group will talk about being in charge of that budget.

Think in broad terms about how to scale spending.

Rob Socolo/Princeton.

Play the wedge game.

Sectoral goal.

Need 7 wedges to get to ...

9:45 Sunil Paul [applause]

Instigator/ organizer of Gigaton Throwdown.

My primary role is as an industrialist

Spring Ventures

invest only in clean tech.

Reason I want to talk to you today -

got into this world of investing - the most powerful lever

to get change in climate and energy security.

As I continued to invest - a friend said,

\"You clean tech guys could make a bunch of money and not make a bit of difference.\"

Solar could increase by a factor of 10 or 20, but that would not matter.

Interest in this category - that realization.

What DOES it take to make a big difference in climate and security.

Jose said this would be a heavy session - a gigton. 1 billion tons.

What is that?

An enormously heavy, big.

Give some idea, more palpable realization of what is a billion tons.

Seems hard to believe that a gas,

something you breathe out every day,

could be so heavy.

A car emits 3-4x its own weight - a Prius for example - emits 3x its own weight in CO2.

If you had to make 1 gigatons - it would take 285 m Priuses.

Roughly entire US fleet. In that magnitude.

Problem is just enormous.

Reason we chose wedge is you need something you can get your head around.

What are the possible solutions?

: Efficiency, less waste.

: Solar

10:05

Major Bloomberg asked to start office for New York city.

Did not start out with the goal of being green.

Long term growth strategy for NY.

designing green results in energy efficiency as a byproduct

NYC has carbon footprint ~Portugal

\"best thing you can do to decrease your cabon footprint is to move to NYC\"

LA needs the least amount of energy to heat/cool

45% of NYC's space is in 2% of its buildings

VC challenge: Want a return of $800 million from $200 million. Can't change laws, can influence but can't dole out money and expect laws and regulations ot change. YOu have tremendous access to talent, brains, etc. Now where do you focus?

Organizing the fund, what are we focused on, what are we not focused on and why?

First:

You have a budget from the government.

What can you do?

Second:

You are a venture capitalist. Responsible for R&D.

Live by the constraints.

Can't change the law.

How do you get to maximum impact.

Third:

You are a public official.

Mayor Bloomberg.

You've got the political equation to deal with.

Challenge - how do you end up having the biggest impact.

10:46 Break

10:58

12:55 Jose:

Anniversary of moon landing

/wiki/Apollo_11

4 cakes.

David Roberts' birthday.

"

/core-Jul7-BB-links

"LINKS FOR SESSION:

( /core-Jul7-BB )

Wednesday

7/7/2010

9am - 12pm

BB CL3 Brainstorm Research Foundation (Linda Avey)

Slides:

BB CL4 Life as a growth industry (Lori Giver)

Slides:

NT CL4 DNA Origami (Paul Rothemund)

Slides:

Suggested use:

Step 0: Check if someone else has already pasted your link.

If so, vote for it with a plus sign (+):

...

[12] AB

[13] CD ++

http://someon

[14]

[15]

...

Step 1: Grab a number

...

[12] AB

[13] CD

http://someon

[14] \x3cyour initials go here>

[15]

...

Step 2: Paste your link and (optional) excerpt and type an annotation:

...

[12] AB

[13] CD

http://someon

[14] JG

/eekim/collaborating-via-artifacts

Slideshare presentation: \"Collaborating Via Artifacts:

Understanding The Real Difference

Between Online and Face-to-Face Collaboration\"

Great example of slidecasting and explation of how on-line collaboration works so effectively.

[15]

...

Step 3: Return to the original Etherpad ( /core-Jul7-BB ) and drop in your reference:

blah blah blah [14] blah blah

REFERENCES:

[0] \x3cadd your initials>

\x3cpaste your link here>

\x3cexcerpt and annotate>

[1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67]

[68]

[69]

[70]

"

/core-Jun28-AIR-CL1-Overview-AI-Robotics-Jacobstein

"Monday, June 28

AIR CL1 Overview of Artificial Intelligence & Robotics (Neil Jacobstein)

Neil Jacobstein

Slides: /present/view?id=0AWIj9HPeinaFZGY2cDNjOXpfMzAwZHAzazY5OXM&hl=en

Audio:

Where are we now? Where are we going? How will we get there? How fast? Are all elements exponential? Lessons learned: early AI predictions and industry, Managing technical and business opportunities, Anticipating and managing risks..

9:04

Salim: Holland won at FIFA.

How many went to Luke's thing? [about half]

Will be quite a few of those over the summer, if you missed it.

Starting now with core lectures. Lectures in the morning. Workshops in the afternoon. Evening events.

Acknowledge unconference: fantastic.

How many for movie night? [most] Discussion after.

TP Survey was due - about half filled it out. Just initial sense. Please fill out.

One of missing students has arrived.

[hug]

SJP: Traveled from Australia

Sarah Jane Pell

Artist, commercial diver

Space analog projects

ISU alum

Worked on luna gaia 2006

TED Fellow

Working on art & science collaboration and intersection

Will be jet lagged. Look forward to meeting you all.

Dan will kick off with AI and Robotics. Welcome Dan Barry.

DB: Neil and I are co-chairs on this track.

One of really big issues: what does it mean to have robot overlords, I mean robot servants.

Introduce Neil.

Formal background

AI R&D 25 yrs for govt and corporates

Standford media program

AAAI for over a decade

Really proud to say Neil is a good friend.

Met here. At curriculum planning committee.

Weren't planning to work together, but he kept making insightful comments.

I'm thinking, \"how am I going to get to work with this guy\"

Low and behold he is chair for AI.

He was more interested in Network guys initially.

We've tried to bring AI & Robotics together.

Initial impression more than confirmed.

For all intelligence there, outstanding thing is his heart.

What really matters in this world.

Neil: Thanks Dan.

AI Overview

Nature has no departments, so we will be interdisciplinary.

Alan Turing 1950

Imitation game - now called \"Turing test\"

\"We may hope that machines will eventually compete with men in all purely

In 1950 Alan Turing published a paper about testing whether humnas can discriminate a sophisticated AI algorithm in which he introduced what was later to be known the Turing test: can machines mimick human intelligence in a way that is indistinguishable to a human)

Newell and Simon GPS - general problem solver

Herb Simon - 1957 predicted computer would beat human in chess in 10 years. 1997 it happened. That 30 year difference was significant.

Important to distinguish Narrow AI (specific problems) and Strong AI (the kind seen in the movie last night that involves the broad deep and subtle intelligence that we link to human intelligence)

[slide of tall contraption]

Shakey the robot -

/wiki/Shakey_the_robot

Three development vectors:

1/ Analytical paths to AGI

2/ Reverse Engineering brain

3/ Application Paths to AGI

- two types

- AI - artificial intelligence

- IA - intelligence augmentation, douglas Englebart

\"Mother of all Demos\" overlapping windows, mouse, embedded video, outlining, hypertext

Not just showing off amazing things, Doug was concerned with augmenting human ability to deal with complex problems. Deeply concerned with amping up people's ability to face these problems. Brains are wired for local phenomena.

But we now have torrents of data and knowledge. Ancient brain architecture, formed LONG ago.

What's the problem? Why should we amplify our intelligence?

*Ancient brain architecture

*Evolutionary hardwired biases

*Limited Attention capacity

*Technology amplifies our power +/-

*Change exponentially accelerating

Obsolete government Institutions.Needs a complete overhaul to be able to solve our challenges.

Navigation requirements increasing rapidly

A lion roar - misinterpreted - resulted in death.We have selection for reaction and if we chose the wrong one we could die from that choice. Limited attention capability, channel capacity.

We have exponential change, governments need overhaul to deal with the speed of the modern world.

Much higher degree of navigation than we have ever had before.

Consequences of not getting this right are severe.

News isn't just bad because of our fear based biases for bad news.

We have some very severe grand challenge problems needing urgent attention.

What can AI bring to the table?

Represent the problem - in a way that machines can understand and apply.

Do inference, if this, then that, NOT that.

all we want to do is represent problems, control them in some way, and then draw inferences from that.

Expert systems - limited success. Why? Could outperform builders. Unfortunately, quite brittle. If knowledge was not in the system, the answers would fall off clifff. No graceful degradation. Difficult to maintain. Expensive to build. Very difficult to keep up with torrent of data from every day life. Acquisition, inference engine, but still -- a step in the right direction.

Range of systems like this to be shown next week.

Exponential curve of computer power has increased tremendously. Vastly more powerful than early AI computers.

1997: Computer beat Grand Champion Kasparov, fulfilling Simon's prediction.

Some observations:

The early predictions of AI were truly naive. Predictions 30+ years too early and had funding consequences. Customer expectation problems. Opposite of Tom Peters' customer expectation mangement advice: underpromise and overdeliver. People will not believe in it anymore.

In spite of this, exponential acceleration needs to be factored in. Now researchers may be unduly sceptical.

I am optimistic that we will achieve AGI, even superhuman intelligence. Be careful about making predictions as you'll be betting the project - find how you can add value at the beginning in the curve and then \"skate to where the puck will be\" - ride the acceration curve

Also interesting to reflect that tasks hard for humans turned out to be easy for early AIs. Irony, humor, empathy are difficult for computers.

Real world problems are domain and task specific. Solutions may require vast amounts of knowledge. We can utilize the power of massive data.

URLs - Uniform Resource Locators - point machines to documents.

Linked data enables people to find individual items in a document using URI

URI - Uniform Resource Identifiers - which a machine can understand and process

Untagged massive data now allows us to harness the \"unreasonable effectiveness\" of data.

IEEE Intelligent systems March/April 2009. Substitute billions of data points and non-parametric models to get machine translation.

Getting amazing results from very, very powerful harnessing of data.

[slide Nwanna's primary attribute dimension]

http://blog.chrisfournier.ca/wp-content/uploads/softwareagent_figure1.png

CALO - Cognitive Asistant that Learns and Organizes

/wiki/CALO

There was the possibility for a system to do massive joins and create a \"lightning strike\" of data to the user

Embedding AI into robots: Sense, Plan, Act

Autonomous robots in cars for DARPA Challenge

Wifi connections of robots to play robosoccer

iRobot has developed robots for military - out of despiration, they produced a vacuum robot (Rumba)

/wiki/Irobot

Open Source robotics - Willow Garage

ROS stands for both Robot Operating System and Robot Open Source

PR2 personal robot platform

Get AI embedded in physical devices in real world.

Also embed AI in built environment in intelligent rooms at: MIT, Standford, CMU, elsewhere.

Deliver some kind of augmentation to users around building and design.

NASA Hyperwall http://www.nas.nasa.gov/Groups/VisTech/hyperwall/

Display device - but not just a pretty display. Each panel has significant processing power behind it. Can be harnessed together to show patterns.

Second Life

Teleplace(?)

Build AIs into educational environments. Like this sphinx.

AGI:Artificial General Intelligence

To get to AGI, we have to do something a little different.

Project: OpenCog, Ben Goetzel.

Using Novamente architecture - go to site and contribute

How do we develop the components. Ben will be here next week, sharing his ideas.

Other threads available: image brain to reverse engineer it.

Understand principles

Electorencephalograph.

fMRI

- locate specific areas involved in specific kinds of processing

Understand construction of brain - diffusion tensor view of white matter

Diffusion tension gradients tell which way the white matter fibers are going.

Model of Auditory Pathway

/neuroscience.shtml

We also have models that were extracted from neuroscience research. Developed a chip that is able to discern speech signal from noise (Young 2003)

There has been a shift from brute force cmputing power to empowering standard PCs to do a very challenging task such as playing chess.

No doubt, we will reach AGI. Not just question of when. How we harness.

What happens after we achieve human level AGI. What values will we embed?

Next generation AI: image of computer based emulation of brain through reverse engineering.

[red line through computer brain]

We won't stop at brain's limitations. It is clear that we are going to break out of that prison.

Useful project would be to integrate all of human knowledge. People can master a couple of areas in a deep way, but no one is able to comprehend all of knowledge now.

This is a slide - every node is a different area of science. (/article/info:doi/10.1371/journal.pone.0004803 ) This map is moving at exponential speed. Imagine the kind of velocity and accelleration of human knowledge.

AGI could be genuinely synthetic in integrating this knowledge

We will no doubt integrate AGI's with our own intelligence.

You might ask,

How?

What would it mean for you? your identity? your responsibilities?

Not only embed in environment, built environment, ourselves, but will control molecules and build the environment that is worthy of who we are.

Q: How much of AI technology ... you showed map. How much needs to built manually?

No hope of building that kind of system manually. Speed of knowledge increase will outstrip manual efforts.

Q: Is first step to build system to understand the meaning of stuff? Still years away?

We have Wikipedia now. Not doing inference. Systems that can. That is not a deep synthetic understanding.

Where do we begin? Get all data linked.

Huge corpus of knowledge.

Need systems which understand semantics.

Long way from systems which understand map.

Q: What is SIRI?

Massive joins of cloud services for specific tasks. Harnessing a number of different services. Does not comprehend huge amounts of knowledge to do that.

Q: Dmitry: You showed that we overpredicted. Are we getting better?

Always a lot of uncertainty. Now may underestimate what AI is achieving.

Try to get multiple data points. Look for counterfactuals. Always build in incremental advantages in your project so that you can deliver value at different stages of the project.

Q: We'll be better at prediction in 10 years!

Good prediction.

Q: David: Do we understand the 2-3 big breakthroughs that need to occur? Like DNA was a big breakthrough. From that framework ...

Key areas that will be pivotal:

Extract generalizations - find what is really common. Some can be done statistically. What are salient features? Will be very big deal.

More raw computing horsepower. You've seen Ray's predictions - we'll see based on raw power.

Other area: whole system for doing active semantics. Underlying meaning of words. So systems could read and learn directly. Would be huge.

Q: Do you mean by generalizations: This is a \"chair\" this is a rabbit\"?

Some systems can classify.

They don't tend to identify and understand general principles.

Bacon could recapitulate some Physics results.

But currently, this is a research frontier.

Q: Bryce/LA:

1/ To what extent is intelligence static versus functionally defined?

a property?

or a behavior?

If we see different behaviors, is it still intelligent.

2/ Tarsky's theories in AI?

On first question: both.

If a machine can play reasonable game of checkers, when Samuel achieved that in 1950s, the question became \"chess\" - then \"go\"- a line-drawing game. We keep redefining what intelligence means

Q: Maybe real reflection of what intelligence is. Perhaps intelligence can't be defined outside a context.

People keep changing the criteria.

We change because we are augmented.

What you can do with PDA or supercomputer is very different from what you can do alone.

Links to our evolutionary capabilities.

As far as Tarsky's theory - ecology of competition. One of many competiting.

Q: /Argentina: distinguish machine learning vs semantic based. To what extent do ...

I like AI because I thought it could be a mirror.

More I work on it, we will be able to be an AI, but it won't tell us much about us.

Depends on the way we build it.

If by reverse engineering, using same operating principles, it might tell us a lot.

Not subjectively, but a lot about human brain.

Other techniques, might tell very little about how brain works.

Q: Do you think this distinction between statistical and semantic approaches are really different?

Converging. Both can use probablility theory.

I don't think there is a never-ending war between those camps.

Q: David: In RK book, by 2045. Later, more whole humanity.

Basis?

What about software?

Graphs refer to computational equivalence.

Some rough correlation, but not same thing as intelligence.

Based on number of neural connections and operations per second.

Q: Does hardware progress faster than software?

Software will keep pace. Computer chess - at first was hardware. With Deep Fritz, software has provided huge value.

Predator/prey relationship. Software requires more hardware.

I've often waited for hardware ...

Q: 1/ List of conservative predictions - no breakthroughs, just growth of hardware and knowledge - where do we get?

Would challenge the idea that exponential growth alone will not produce breakthroughs, quantitative differences will yield qualitative changes.

In 10-20/25 years to AGI. Reason for error band, depends on how you define intelligence.

If you have specific idea, people might just work in that idea and achieve it early.

If you want an AGI solution, might take longer.

Q: More data -> AGI?

Not just more horsepower.

If collaboration around world, tremendous increases in processing power, just by incremental improvements, we could reach AGI, but it depends on what people work on.

Q: Blind spots. What can't we do? What will AGI never be able to do?

Very difficult to answer, given my blind spots.

We ought to run the experiment and find out.

Q: Sasha/Canada: Self awareness, creative expression. Part of AGI?

No areas of human endeavor are walled off from AGI.

No magic process (like creativity and self-expression) inside human being that is walled off from AGI.

We will build machines that do everything humans do and then some.

Q: Protectionism from humans?

Already seen it in low level form.

Seems to me that most important thing to do is to take care of the basic security and survival needs of fellow citizens. Address the Grand Challenges. Lower levels of Maslow's hierarchy. Let them live in a realtively high quality of environment and the push back will be a lot less.

Q: Manuel/Spain: Types of problems to solve are limited. NP

I think when problems are extremely hard theoretically, what we will see are various forms of attack. Machines will attack problems people will not be able to solve. Later, machines will push limits.

Dan Barry: You know that the problem is fundamentally difficult. You can come up with something close.

Instead of solving analytically, I'll solve numerically. Not going to solve it perfectly but can get close.

Q: Brazil: AI can lead us to AGI ..

lk

To clarify, I don't think incremental progress will necessarily lead to AGI. But it could, given exponential acceleraton.

Q: Narrow AI. Forecasting. Human - merge narrow AIs to simulated ... put in cloud. If this would be framework for general intelligence?

SIRI (recently bought by Apple), CALO

/2010/04/29/apple-acquires-siri-may-the-voice-powered-wars-begin/

Not final answer for AGI. Not satisfactory architecture. More brute force. We'll come up with more elegant solutions.

Q: Human intelligence - life experience. Building through nodes. What about crowd sourcing? Collecting through games, develop AI much much faster.

Protein structure in 2 weeks.

Really interesting.

Conflates issues.

Super human by networks of people

Really interesting and effective.

Multiple - achieves a kind of super intelligence.

Other issue: can we achieve an AGI by piecing together. May be possible.

Architecture for doing that is pretty week.

Not on wiki.

Maybe on opencog

Collaboration by adding tagged data and things can get you partway up the curve on AGI

Human-level AI and beyond will probably come through more elegant solutions

Q: Can we build a system that learns from people?

Right. David Canfield Smith built systems to watch, infer - what kind of problems humans are trying to solve. You can get interesting results. No one has taken it to the point of watching humans, then going off on own.

Powerful rule: use massive amounts of data. Will be good at classification, but not broad, deep features of human intelligence.

Interesting, but needs more architectures.

Eric/Italy. AI on human brain. What about other intelligence? Tropical forest. Studies look at this for collective intelligence.

People building on Gregory Bateson work. Feature extract properties.

Heterogenous fields that don't talk to each other.

Ecosystem is on fringe of AI. It would be wotrthwile exploring this.

Q: Shary/US What perspectives are active in AI community?

Computational?

Cog/Psy?

Cog/Psy - Simon and Newell. Beautiful book. Whole conferences on cognitive psychology and AI.

Less so with organizational behaviour.

People most needed now

Computational Neurobiologists - search to find really talented people.

Q: Eugiene/France: what lab to watch? What is most advance?

What could we learn about collaboration between robots?

Leading Labs?:

Depends on interest. Hierarchical Numenta, Redwood

MIT, Caltech, Stanford, CMU - All have some kind of AGI

DARPA community, typically one or more

Intelligence community.

/

http://redwood.berkeley.edu/

http://www.csail.mit.edu/

http://robotics.caltech.edu/wiki/index.php/Main_Page

http://ai.stanford.edu/

http://www.cs.cmu.edu/~softagents/

Collaborative Robots:

Have to adapt to environment.

Quick feedback loop - plan/act/cycle

Fast learning from environment.

Interesting difference between static AIs.

Salim: Neil is core faculty. Time to ask questions.

Back in 7 minutes.

10:18

**********************************************************************************************************************

NOTE - we will continue with the EtherPad for Dan Barry's talk

Salim: NASA introductions

This is a lecture you will never forget for the rest of your lives.

AIR CL2 Adaptation & Cooperation (Dan Barry)

Slides:

Audio: /leaf?id=0B0vcBiirD3NQOTczZTA2MzItMzVhNi00NjRhLWEwNTItYWUyYjc3MTQ0N2Mz&hl=en

AIR CL3 Robotic Communication (Dan Barry)

Slides:

Audio: /leaf?id=0B0vcBiirD3NQZmI3NWIxODUtMGQyOC00ZTQ3LTg0YzktOTRiYjE2Yzc2ZWRk&hl=en

Dan: Neil has talked about AI. Now we will talk about AI in the real world.

That's not what I'm going to talk about first.

Principles of robotics.

I want you to remember

adaptation - respond to new situation

A second key word to take away today is cooperation trumps compeition in many situations.

Video - history.

German V2 blowing up.

Important to keep the pointy end forward \x3c\x3c key concept!

Now control system issue.

Really not good in rocketry.

No one was hurt in any of these videos.

$1 bn loss in 10 seconds.

Chinese - not just US and Germans that don't get it right.

Remember this is day one on the new job that you get this video.

Space X - just 3 years ago.

This one is pretty. Announcer is \"descriptive\"

\"It appears we have had an anolomly\"

Firestorm on ground.

You don not want to stand within a mile.

This is Cape Kenendy

More than 2 dozen cars are destroyed - windshields and tire rims melt.

So conclusion? Space Flight is Difficult.

You are getting ready to ride on these things.

People designing these rockets are bright people.

But from 1940s to last year, they blow up.

Every rocket, they put 4 in the ocean.

Why?

Why do you think when you build a rocket, using 50 year old principles, do they always blow up?

Everybody loses rockets?

Q: Complexity?

Sort of. Well understood. By the time Space X is launching.

Q: Explosive things on fire.

We do this with cars, trains and buses. We built a computer - see the wire in that sucker? It ran when we turned it on.

Q: Limits?

Q: Using compoents for first time?

Never tested in env in which it will operate.

They have to perform perfectly first time.

Why can't you test in env?

No zero g.

Test stand is different.

Talk to Glenn - pogo - a resonance. Sloshing of fluids. Doesn't happen unless suspended in air.

Very first performance is first time.

Second = no ability to adapt.

One regine. All they will do

No ability to recover - no intelligence. no adaptation. Fundamental reason they fail: Adaptation.

Difference between machines and biology is adaptation.

We adapt at every scale: Every time and place.

We have immediate adaption.

Tennis - intermediat forms - you learn over years.

Long term evolution

Now adapation is in our environment. Tranformed equation a bit to the point we are transforming the climate.

Climate change allows shortsleeves shorts on Mars.

Having said that, I want to show you form of adaptation the best I have ever seen.

Hope you can see this bit of algae. Holy crap - octopus. Think of adaptation. Watch in reverse.

Octopus is matching all the attributes of it environment.

Don't put octopus in a cage that has any openings at all.

[video of octopus sliding through tube]

This iswhat life is like with no bones.

Less than 10%of body size.

Seattle put octopus with sharks - and sharks died.

If in Caymans, don't dive too close to algae.

That is adapation in animals.

As a clinician,

rehabilitation physician

Extreme arthritus patient.

Husband has cardiac issues.

\"I can't go to store because I can't start car. Can't hold pen. Zip zippers.\"

\"We want to live alone - no assisted living.\"

I'm listening to this fiercely independent woman and thinking this is what I went to medical school to help.

She pulls out tube which has key in it.

Pulls out hook - big handle, button hook. Now you can dress yourself.

List of 8-10 very simple tools that transformed her from dependence to independence.

Trivial cost -> significant difference.

Simple engineering to transform people's lives.

Saw so many other people with similar stories.

Spinal cord injury patients.

Think of the fear. Won't move arms or legs for the rest of your life.

Even that very first moment, chance you will never recover.

It is everyone's nightmare. First thing people want to do is commit suicide.

They ask physicians to let them die.

They have reactive depression for a long time.

Physician's role is to realize it is a panic attack.

Turns out, 3 weeks out. Meet others living indpendent lives.

You can live productive lfe.

Make friends.

Mind makes decision how to push past that.

We literally duct tape hands to oars. Get them paddling on the river.

Back to minimally assisted liveing.

All throug adaptatoin.

Something that happened to me: Not a disability. Positive adapation.

Our bodies change so fast, they adapt to zero G.

you can get lost by being upside down.

When we train, read book, flip switch.

Does space make people stupid? Why going 1 2 4, skipping 3.

Q: Disorientation?

Negative training.

In space, you are floating. You hand is floating. So your hand and the list float.

Your eyes land in a differnet place.

Now, mark through steps.

Takes 3x as long in space due to external adapations.

Best story. Pilot in right seat. Only person after engines shut down for doing important stuff.

Hydraulics working. In right orbit.

Buddy says, \"I was trying to be a realy good pilot. Everyon having a great time. One guy has his hand in front of my face. I got annoyed, hit the hand. It is his OWN hand.\"

Lost corpre-hensive? sense.

Used hands to find where hands are.

At bedtime in space, My own hand was banging into my head. Only happened that first night.

Don't know whether adaptation was to sleep through bumps or stop doing them.

Rookie's job to make patch.

by the time you are on your third patch, you just want you name spelled right.

Supersonic jet.

Houston to FL, hour and a half.

Talking in cockpit

T38

3 min in Shuttle.

LA to Boston in 10 min on Shuttle - if you are late to work or something.

Talking, going to go tonight? Finally time. The dream starts to come true.

Crank the sound

Shake and Bake

[Shuttle liftoff video]

2 min in, drop big boosters.

Only 3 Gs

8 1/2 min to orbit

Parallel parking at 5 miles per second

ISS at 17,000 mph

\"If not careful, you're going to hit that thing\"

Opening hatch. Bringing home crew - we were two months late.

Commander was REALLY happy to see us.

At this point, set record 10 people in space.

Safety briefing - what big red buttons not to push

Work you do is technician level work.

Batteries

Radio repairs

Installing mufflers - fans were loud

Fixing squeeky doors.

Trained on earth - 3 at a time. In space - 1 at a time.

How would you practice on Earth?

Culmination of Astronaut career is going \"outdoors\"

Spend a day preparing

You just learn how to do it while you are there.

Takes 2 hours to put suit on

You really don't want to miss a step here.

Marine colonel - renowned for following steps.

you HAVE to check off each step.

Opening door, stepping outside.

I'll talk later about beauty of environment.

There is a robot there. Very little autonomous robitics.

Always something goes wrong.

Bolt doesn't drive wiht power tool.

Ingenuity. Fix something right now.

Back indoors, work out at gym. All spring driven. You lose bone and mass in space.

Bungee holds you on treadmill.

Stupid astronaut tricks. Spinning people \"My eye balls are going to fall out!\"

Put students in middle of classroom - that's where they cant's get away.

Playing with food.

Tons of switches. Dog puller(?)

Beautiful , silver winged dragonfly.

Mr Junior Science - magnets. Gave me behavior I had not anticipated.

No convection of fluids.

You can drink out of ball. Won't stay in cup.

Tammy on 5th flight. Goldfish. Loot at dynamics of water ball. Cracker Goldfish (no animals were hurt).

Rest of crew came to help.

No convection - study surface tension in isolated environment.

Used dental floss to bring two fluid balls together.

We do a lot of student experiments.

Disco Shine. Stayed up about 6 months.

45 minute task coming home. Flashes are giant fireballs. Like paparzzi.

St. Elmo's fire.

Shuttle is like slamming into waves on a boat. Rattling and shaking.

It is aglider coming in 8,000 miles away. Drops like rock. You've been in sapce.

No g's for 10 days. You do it. Training takes over.

No gear until 300 feet off the ground.

done these - and everyone has worked.

Roll down runway, let go of the shute.

\"Wheel stop.\"

You've done this amazing thing. We all went and did this thing together.

You body says, \"Im not done with you\"

You are in your chair, exhausted. Ready to be greeted by friends and you can't stand up.

Legs go \"nope.\"

You sit there.

I know in 9 days my muscles are not the probelm.

Why can't I stand up?

First, a story. When you first get to space. The pilot and all. Woohoo, I'm in space.

Wife said, \"Hey that's Dan\"

What am I going to do: Tom Hanks. Floated glove in front of his face.

\"I really am in space\" unbuckled.

Dreaming of flying.

Push off from wall. Seeing other wall. Realizing I am going to hit it.

Half way through the cabin, I start kicking.

Vetrans in corners - so rookies don't kick us.

Tunnel - push off with pinkie.

You fly down tunnel. You see yourself start to drop.

Your body is tilting, not translating. so you kick with your feet and cram your head right into bulkhead.

Within 3 days - you konw your center of mass and fly like superman.

Next flight - home, not house.

People there 4 months have ADAPTED, learned how to live in space - dancing.

We are sitting together - not just physical adaption but also a not just physical adaption but also a mental adaption. Tasks done.

\"Lunch time\" we don't do that in space.

Staion guys do it.

Working in space, living in space - you can't work all the time.

Human beings need to have some downtime.

So - back to the issue - what isoing on with my legs.

SJP: Body memory.

Legs would push you through ceiling if used!

Bed pushed so hard. Felt I would blast through ceiling.

They say, \"Great job\"

Technician hands you clothes. You leave them right there. [holds hands out in air]

And what do they do? [smacks podium]

Gravity sucks.

So they tell spouses of returning astronauts: \"Don't hand them the baby.\"

[applause]

It takes a few days - no driving car. Couldn't fly plane.

Could not walk with eyes closed.

2 year later, 3 years later flew again.

No conscious difference - took 1 day.

Next time - 2 hours to readapt.

How can you take 3 days, then years later do again, body had figured out how to do that for you.

Nobody knows how that adapation occurs.

SO, what does this have to do with robots. Supposed to be a robot lecture, right?

Robots are not very adaptable.

Things that you think of when you think of human intelligence

are wrapped around this idea of adaptation.

YOu can divide robots into autonomous and non autonomous

General purpose (a rumor) (no particular function but able to do just about anything) vs. special purpose (in a factory)

therefore 4 possible types based on the combinations of those two types

EXAMPLES:

I. Autonomous special purpose

Video: Autonomous welding robots, people on floor is in very serious danger. No joysticks

Video: Warehouse robots: Kiva (/index.html) a company that creates robots to carry items in a warehouse. Autonomous and special purpose. A huma in the loop, robots bring material to the humans. , Andy Barry use to work for Kiva

Video: Robotic fish

Video: Flowers combining robotics and art

II. non-autonomous robots special purpose

video: articulated hand controlled by a real hand, robo astronaut, robotic surgeon (da vinci)

video: big dog! walking robot for carrying heavy loads, Boston Dynamics mix between autonomous and non-autonomous

video: petman, two legged version of big dog

video: packbot, goes up stairs, durable enough to go through windows and jump off cliffs and water proof

\"better than a timex watch\"

III. Autonomous general purpose robots

video: leonardo - gizmo looking robot, expressing emptions towards elmo vs. cookie monster

video: willow garage opens door

/

video: swarm, 278 robots communicating with each other, co-op behavior among many robots

[?]

When do robots NOT work:

example of robots and humans working together, some times it's good to have humans other times robots should stay in control

example: video of famous captain Sullenberger landing the passenger airplane in the hudson

Plane hits a flock of birds. Engines catch fire.

\"Lost thrust in both engines\"

Now heading to water. Very smart. If headed back to Laguardia, would have had crash.

Negotiation for Tetterboro landing. Pilot still hasn't turned. Focused on landing safely in Hudson.

\"Newark airport in 7 miles ...\"

Still trying to restart engines.

Out of ideas.

Lands in water.

That's it. Everybody lived. Everybody survived that because you had a person on board who understood the priorities. Person sitting next to him. Solved problem in real time.

Guy on normal takeoff. 10,000 hours. Notice how quiet. ONE comment on how pretty Hudson is. Cross check.

Captain recognizes hit. Takes control of the aircraft. Calls for procedure, rather than trust memory. He has already done boldface. Get started before you get book out.

Go through and cross check each other.

Cockpit warnings going on.

Trying to decide.

Methodically - assessing state of engines.

Air trafic control is helping.

Started to return to field. Then you hear him say, \"We have the runway ready\"

He didn't KNOW he could get back.

People on ground would die.

Crash in Hudson - no one on ground would die.

Other thing, over Hudson - has a shot at having some survivors.

Trying to get both engines. Guy looks out and sees Teeterboro.

OK, fine.

He then makes assessment, that he might, but might not. Waits to make turn.

If he gets decision YES, then he can commit.

Hoped engine relit.

Not going to happen.

At some point he puts focus on landing in river.

Flaps down.

Most brilliant. He says, \"Got any ideas?

He is ready an dable to listen for someone to tell him ...

that is having real control

think of all the variables, controls.

Thank the lord there wasn't a robot.

Contrast Colgate (?) chat about things.

First officer see ice. \"Very uncomfortable flying in ice\"

Never seen this much ice - 5 min before plane goes down.

Complacent.

Robot part of plane starts to shake the stick.

First officer raised flaps, made plane unrecoverable.

Two things - crew on top of it, other crew didn't take adavantage.

Not always true that humans are better at responding/adapting.

Given what you now know, I come back to opening ceremony question:

What good are robots?

Only Shary got back to me. Kudos.

So, it remains an open question to you.

I will tell you what robots do in my house and my company.

Nothing I can't do better myself.

We are cheering that it can fold towels.

Can get pizza and that is about it. Learned a few things, people are honest and never stolen from the robots and adapt quickly after working with the robot.

The point is to transport a person from dependence to independence using robots. Add the element of intelligence to the robot and it transforms the persons life.

HOMEWORK: What should robots do in my house? How do we make Q/A time more interactive with everyone?

12:00 Lunch

[end of presentation]

"

/core-Jun29-NCS-CL1

"Tuesday

6/29/2010

9-10 am

Brad Templeton/Salim Ismail

NCS CL1 Network and Information

Slides:

Audio: /leaf?id=0B0vcBiirD3NQYWQ1YTQyZTktNTNkMy00NjBlLWE4OGEtZTJkYTFjYmJlMGRm&hl=en

Presentation slides: /slides/singu-intro.ppt

All Our Ideas crowdsourced questions: /gsp10ncscl1

[Networking for Dummies Books: /store/Computers-Internet/Networking.html]

\x3cnotes start here>

Color card definitions

Green - Agree

Red - Disagree

Yellow - Slow down (content) / I don't understand

Grey - Speed up we know this stuff / Move on to another topic

hands moving apart (sideways) - speak slower, speak more clearly

Computer's are getting faster but the bootup speed remains the same

What makes a revolution?

- Build technology for early adopters

-Nobody who can tell you \"no\"

- early adopters are usualy stupid people with too much money :) - willing to waste their money to stay ahead of the curve

-early adopters provide a market for new tech

-Insatiable market demand for doubling, less demand for incremental improvement

-Disruption!

no permitting process

The personal computer had its explosion in many ways as reaction to restricted mainframes.

People bought their own computer and it was THEIRS.

It is amazing how having to ask permission slows down development.

You want an open and hackable platform, you want a culture of talent. Competition to get to these early adopters.

Store full of stuff, including wire-wrap boards. For individuals to be buying this stuff for $20 drives revolutions.

Market wants things 2x better, not 10% better.

Thanks to slow boot - you want and need a faster computer.

Your old computer is seen as a dinosaur.

Moore's Law is not a principle of nature - it is a marketing order.

It became self-fullfilling

$1 bn was spent making the fabs to make those chips.

Book referenced: /Free-Future-Radical-Chris-Anderson/dp/1401322905

Revolution in Networking - the internet broke a lot of rules.

Packet-switching networks were \"smart\"

Big institutional approach.

Internet tried something much more basic. David Isenberg [?]

Just get packets, put an address on it. Network does not try to be \"smart\"

Instead it only promises it will do its best. Not a guaranteed system.

Eric: Can you explain what a packet is?

On phone, you had circuit.

We may be meeting Vint Cerf.

Break into a few hundred bytes of data. Mine and yours stream together and get split later.

Some to Boston, some to Santiago.

Idea was, very simple system. Packet switching.

Let people innovate in boxes at endpoints.

That lets people do the innovation where no one can tell them no.

When someone comes up with something cool, they can do it.

Actually cheaper to fix the capacity and congestion problem by buying more bandwidth, rather than trying to get smarter.

Break network neutrality rule ... may not be best way to go. Misguided.

Another important thing - pricing related.

Best invention, not packets, but cost contract.

I pay for my line to the middle and don't care what goes in between.

Each building wire to the center.

No body could say no.

First famous application - coffee cup or fish tank in Internet lab.

Everyone wanted to see this.

If they had been charging per megabyte, guy would have had big bill.

Basically it let people experiment.

YouTube - people experimented.

No \"bean counters\" (accountants)

In networks,

The internet isn't free but because of the flat pricing, it appears to be

Optical fiber now at 69 terabits per fiber with Dense Wave Division Multiplexing (DWDM) - equivalent to everyone on earth being on the phone at the same.

This includes multiple colors of light so you can send more information at the same time

Free Space Optics (FSO) - 100s of gb/s, terahertz

People think there is a limit to the amount of spectrum available.

This is the actual of Wi-Fi miracle.

Take piece of spectrum. No body thought that

One very interesting rule. Your problem if you got interference.

I think that resulted in the greatest innovation in radio -

cordless phones

sprung up out of nowhere.

This lesson is slowing showing up.

Cognitive radios - not blind. Understand which bands to use based on which have the least ammount of interference.

Whitespace - frequency allocated to broadcasting service but not used locally, FCC ruled that these can now be used if they don't interefere with assigned broadcasts.

Lot of TV channels 2 to 59. Only 11% still get TV over the air.

Not 60 broadcasters. A few dozen at most.

Smart device could see no one is USING channels, jumps in and takes advantage of it.

This is being fought.

As long as big companies don't get in the way.

Glass roots revolution.

People buying fibre connecting to next block.

Freespace links. Changing the world.

Not a lot on programming languages.

In the beginning, low level - close to the machine.

Early on, probably C.

More common now is higher level - further from the computer. More abstract.

[JG: I like Python for example]

Result of this scripting is that programs are bigger and slower. Rely on features like garbage collection - reallocating memory that is no longer being used.

Different mission.

Waste resources - memory, hard disk,

and not waste your own time.

Sooooo many transistors, no need to make layout perfect.

Human time became more important than other resources.

So software bloated.

Fundamental theorem: \"Every problem can be solved by adding another level of indirection.\"

You have a name for a name that points on.

Let's you change things - implementation - at any level. Very powerful.

In virtualization, there is a lot going on between intent and implementation.

Next presentation will cover this.

PLE lecture. Another trend: software recall.

Legal consequences.

Companies can update software remotely.

Each package starts a new daemon. \"Is there a new program ... is there a new program\" Hence slow boots.

PlayStation 3 - disabled capabilities

IPhone

Amazaon 1984 \"unbooked\" deleted from Kindles.

Could they have picked a better book [?]

People are trying to abstract even more.

Virtualization - something that looks like a computer inside the computer.

You might have Parallels - looks to Windows like a Windows PC (running on Mac)

Build a room that puts virtual computers inside computers.

Computing on demand.

We can sell you a hour's time - Windows Linux (not so much Mac).

You can buy 1 or 1000 for an hour.

Trend: Cloud Computing.

I will rail about second one - take personal data and store it on machines owned by 3rd parties.

This is the trend. Can delivery massively parallel computing. 1000s and 1000s of computers on demand.

Goes from big computers (main frames) owned, to time sharing, to PC, to client-server mix, to finally this cloud thing, \"Web mosft

something\"

People trying to do more in servers.

All desktops - all that matters is running Javascript.

Media.

History has axis - serial vs browsed. Push vs sampled.

E-mail 1, then another.

Blog, serial.

Magazine.

On-line is like that.

Browser - hop around. Not prepared sequence.

Two types of serial -

IM

SMS

vs

Serial you ask for:

Blogs

E-mail

Sampled is old/new.

Twitter. Interesting from other streams, you don't follow whole feed.

Other than surfing TV, this is a new type of media.

Other axis: reader vs writer friendly.

NY Times is reader friendly. Pyramid style.

vs

Wiki is writer friendly - easy to go in and change. Hard to follow.

Browse, but otherwise very writer friendly.

Use categories to help understand.

All new media create information overload.

FIND new? Ah .... I don't get enough! Too much signal.

Signal to noise - how much good to useless.

Too much good information on Internet.

Problem is not finding but filtering - you will deliberately NOT read all that is good.

FREE model. David Rose.

When you want ad revenues, efficiency issue. How many ads did I show to people.

How many leads?

TV ads - 30 seconds, gets 2 cents to network to show that ad.

You get hooked to buy product.

Google gets 2 cents. How many spend 30 seconds. Eyes spend 1/2 second.

google is deliveering same value to the advertiser in much less time.

Delivers value of ads to you 50x better.

Coming up: next 10 years of hardware and software.

Open source Wed. Visit Google

Quantum computing.

End of the week: social media/networking.

Wed: City of the future - wired and full of robots. Delivery robots take things around.

(brad's website - can see his current book project)

Workshops on the internt of things.

Room full of cubes in silicon valley - not good site visits.

Visit Frye's

Exploratorium.

Tech museum

Hacker Dojo [JG: Yes. This was cool!]

At NASA, Homebrew robotics at building 23.

Kathryn has calendar here: []

Jan Gray.

Went off to work at Microsoft to examine strategy.

We built them one way, now multicore.

Changes what computers, especially software, have to do.

Will get much more technical.

Moore's law is at the basis of everything.

Jan:

- Scaling Up Computing Power

Slides at /leaf?id=0B6vjqTaW5opaYWU0MWJlODctZWQzZi00MTk1LThiN2UtZDlkODNjMWMwODAw&sort=name&layout=list&pid=0B2Ij9HPeinaFODJjNjVlYTItNTlhMC00YzI0LWFlZDEtM2U3NTg3ODc5OTNj&cindex=1

Audio: http://bit.ly/9ORmN4

I was born when Moore's Law was framed. Hope it will keep scaling up.

Around 2004, ebb in performance scaling. Run from 1970 to 2000. Doubling every 2 years.

1 MHz to 3000.

Each clock cycle did more.

Heat disappated went up.

Rounding off of clock speed: 3 GHz

Yet we've gone from 10,000s to millions of transistors on a die.

do we have a good c?

architectures - how to spend them?

How does software change?

Some electronics. MOSFET

Transistor is three terminal device. Source, drain. Control gate.

Channel has semi-conductor material.

If NO voltage, channel doesn't conduct.

If positive voltage, you get conduction from source to drain.

[Video - sand to silicon chip]

Make one large silicon crystal.

Slice it.

Photolithography.

A resist. Expose through mask with many many copies on round wafer.

Etch, deposit.

Build parts of transistor - 9 layers of metal.

100s of saws cut it up.

Several hundred billion transistors on that one die.

[Chart from S. Borkar]

Each 2 years, we go into a new technology Node. Smaller by 0.7x. Doubling in 2 year.

Quadrupling of transistors on a die.

Quarter of a trillion transistors on a die by 2018.

Rate of speed improvement is going down. Not as well as they used to.

Then it will slow down to every three years after that

Extend 193nm refractive lithography

Optical proximity correction, double patterning

13nm EUV lithography

soft x-rays, vacuum chambers

Transistors:

new material in gate, insulator, channel

DRAM - capacitor, 2x/3y

FLASH PROM - floating gate 2x/1.5y 64gb at 25nm

3d: stack cells vertically

resistance change/phase change RAM

amorphous/cystalline

Slowing of transistor doublings (now we are 2x in 3yr)

But.. cost halvings still continuing - \"22nm ought to be enough for anybody\"

Computer Architecture

1986-2002, computers 2x in speed every year but now its leveling off

Instruction Level Parallelism (ILP) [cut and paste from slides]

Spending Transistors on Performance - run programs 2x as fast

L1 cache reduces memory access time

Branch prediction for determining where the program is heading

Vector operations FPU's for working with videos/graphics

Over 30 years - CPU cycle time 1000ns -> 0.3ns but DRAM access time 500ns -> 100ns

sometimes progress stops for hundreds of nanoseconds

\"The Power Wall\"

Over last 30 years: die size larger, voltage 15->1v, frequency 1->300MHz, Power 1->100W

like the heat of a rocket at 1000x and surface of the sun at 10000x, just can't go there

P porportional to CV^2f

the power wall is the limiting design constraint

\"Complexity Wall\"

diminishing returns in wide-issue machines

only a tiny part of the die is actually doing processes

\"Explicit Parallelism - Multi-Core\"

much more area efficient

power wall is still there, how to solve?

finesse power with lower V, lower frequency, sleeping of transistors

finesse memory wall with memory parallelism

can't think of anything better so let's see if we can get the programers to get it to work

32 cores = 1 trillion floating points per second

Single-Chip Cloud - 48 individual cores

\"Scaling Up Memory Bandwidth\"

TFLOPS need TB/s of data.... 100s of GB/s not nearly enough

solution: bumping, die stacking

\"Silicon Photonics\"

should surpass copper traces for non-local interconnect

optical links at TB speed

Die stacking + Photonics = adequate bandwidth for next generation

\"Graphics Processor Computing\"

100s of cores

1000s of threads

Graphics module is very accessible to scientific and technical computing.

GPU use is still \"black magic\"

Game enthusiasts buy $500 boards and drive supercomputing.

Nvidia chip with 500 cores.

/content/global/global.php

/object/cool_stuff.html

Systems on Chip, Network on Chip, Modularity, Heterogeneity

database with large cores, small cores, media cores etc... mix and match for different problem domains

After 2015, a lot more fault detection on chips

Eventually to the point that computers are modular/stackable

iPhone G4, optimized for low energy

Eurocloud - research project that makes 3D cloud computing on a chip

Break at 10:26

Brad: I hope this was good. [Green and red card votes.]

Building a chip today is like trying to paint art with a paint roller

Connor: SU exponential technologies. Age of abundance.

How will computer design / chip /datacenter design when energy is limitless.

Jan: All large scale production systems will be expensive, hard to deploy. Don't know where ..

IF we had unlimited energy, constraints would go away until planet melts down.

Brad: Unless we come up with technologies, like reversible computing.

They get as hot as surface of the sun.

Jan: We'll just use lasers to put energy in space.

Brad: Or put computing in space. [Dmitry?]

Eric: Glass revolution. Explain a bit more. People-to-people.

Brad: In English, Grass roots is something coming from bottom.

Markets have exponential growth. If networking is done at grass roots, connecting neighbors with Gigabit.

Like Wi-Fi - always a hotspot somewhere near you.

Sometimes give away free.

Revolution of access.

Take that model so you can go to local electronics store.

Fibre is safe.

Not worth stealing - unlike valuable copper.

Sends immense amount of data that does not involve phone companies.

[applause]

: Wondering about cloud. What is next?

Brad: Stratosphere. Proposal to put computers in space. Actually latency to LEO is quite good. As good as using something on your desk.

Other proposals - quantum computing next week.

Strange rules of quantum physics to do computing in small groups of atoms.

May still have clouds of quantum computers.

That will stick around.

Jan: 50x or 100x cost reduction of processors in the cloud.

Brad: Buy computer today, run for 3 years. What is most expensive part:

The ELECTRICITY.

Not fixing that well right now.

Home energy track may address this.

Dmitry: Vacuum of space? Cold? Problems.

Brad: Only cool by radiation. Not so good.

Dan Berry- when they take laptops into space, they must put fans on them because cooling does not happen by convection in AIR.

: So the cloud is built and operated by companies at the moment. Should it be?

Brad: Next session.

Brad (GSP Brad):

Jan: PhysX - software physics interface. Discontinued ?agea?

Now in GPU. Gathered they felt scaling of GPU did Physics stuff without using 2 chips.

Sarah/ Australia: Potentials for supercomputing involving biological systems? Interfaces?

Jan: Lovely image of chip + neuron.

Inspired architectures - neocortex type in hardware, very interesting.

Brad: DNA computing?

Very slow, but for free, DNA will grow and may come out with calculation.

Jan: Biological circuits. DNA has nice property of complementary base pairs. Some parts of the strand bind tightly. Others left dangling. You can do AND gates. Strand activates whole other computation.

Not aiming for TFLOPS. Rather simple computation to unlock drug at particular site.

Kind of taking experience with computers and getting state, amplification in DNA strands.

Sky is the limit on what you could do with this.

Brad: You guys have been very interactive.

Tony / Korea: End of Moore's Law? Society is depending on it - some industries would close? Implications of plateau?

Jan: Every technology has one of these cycles. Fortunate technologies go through phases, slow down, turn to new technology.

Theme of this talk - uni-processor slowed, however with more cores - with parallel software we should get back to fast rate of scaling.

Not stopped growing - still getting 10-15% better. That is amazing.

We will either transition to something else or cheaper ...

Brad: Pause now. Come back in 7-8 minutes.

10:43

NEW PAD AFTER BREAK:

/core-Jun29-NCS-CL3

[end of presentation]

All Our Ideas crowdsourced questions: /gsp10ncscl1

Please take 2 minutes to vote for suggestions.

"

/core-Jul19-SPS

"7/19/2010

Monday

9 am - 12 pm

OUTDOORS near Building 20

SPS Session: Implications of Galactic Communities

Dan Barry

How fast do you need to go?

If you are pushed at 1 G throughout trip, you can get 6 nines.

99.9999% of speed of light.

What's going to happen, we are going slow.

Earth time and ship time are the same.

As we start going really fast, Earth time slows down.

It allows you to go to really far, distant places.

Explanation of why times slows down on a ship.

Dilation.

What is the deal with relativity.

Speed of light looks the same, regardless of frame of reference.

Walking along together - he and I are not moving relative to one another, but we are both moving relative to you.

Speed of light is going at the same speed regardless of perspective.

Why does light always look the same?

If it didn't then you could go the same speed as light.

And, if you did that, you could look at a light beam.

This would violate physics.

It is an oscillating field.

Einstein said, you can never catch one.

Sounds like a cop out.

Other people came up with other explanations.

But you base predictions on your cop out answer.

It might have been Dobachevsky.

But Einstein got the right answer.

Trick is when your hypothesis predicts physical things,

people do those experiments.

Newton was on top for awhile.

Someday someone may replace Einstein in terms of accuracy.

Clocks go tic-toc.

Now what happens if I move the whole thing.

Does it change the rate of tic-toc if you move it?

It changes the distance the photon has to travel.

You can take that to the bank.

It all boils down to pythagoras.

A lot of you look skeptical.

You all now understand the entire basis of special relativity.

Inside your ship, time is running slower.

Alpha Centuri - 4.3 light years away.

You cannot get there any faster than that.

If you get on ship accelerating at 0.1 G - it will take you 13 years to get there.

12.x on your calendar.

I see you get there in ~6 years at 1 G. You get there in 3 yrs.

You can get to A C in \"2 years\" if you accelerate at 2 G for the entire trip.

Spend time -

Who wants to go to Cyrius - 9 light years away

0.1 20 17 on board

2 G? 3 yrs on board

Bettle 520 l y away - - 7 yrs at 2 G

Center of galaxy - 10 lightyears

Andromeda - 15 yrs.

On Earth, 2.2 m years.

Round trip to Cyrius - 18 years on Earth. You'll be 6 years older.

Q: ???

Got to figure out where it is going to be when you get there.

Orbital mechanics.

How fast can you ultimately go?

What is the limit?

Energy.

Can only slow down so fast. True.

Mass. Another effect - as you go faster, you become more massive.

You also become shorter in the direction you are travelling.

Ultimately, as you compress these things, you turn into little black holes.

So, that occurs,

let me just show you

black hole has characteristic mass

Equation is very simple

Radius = 2 x gravitational constant / c^2 = 1.5 x 10^-27 m/kg

A very small number.

For 1 kg, say, you would have to shrink it to 10^-27 m in radius to turn it into a black hole.

Pop.

It becomes a black hole.

Electrons have radius 10^-24 m.

So what mass would electron have to have?

Mass would have to be 10^3.

If you can make your electrons be 1000 kgs, about a ton.

If an electron weighs a ton ... well, that is hard to do.

But it will when you get up to 16 nines.

99.99999999999999% of the speed of light.

When you get going fast enough,

Maybe your protons go first.

I didn't do that calculation.

Just as bad for you.

Erez: Is that a relative effect? So outside they think you are a black hole, but on board you are not?

Yes.

So, what does this mean.

Kids can go to college on Vega.

It means, I can order a pizza from 10 light years away.

Dominos makes the pizza with 12 9's. Pizza can get to me in an hour, still hot, but 10 years since I placed the order.

Guy gets paid 20 years later.

So, what does that mean? A stream of pizzas, constant - you need to trust the people you are dealing with when delays get long.

10 teams.

Break up.

"

/core-Jun30-FEE

"

.Wednesday

6/30/2010

11:30

David Rose

Future of the firm

Slides: [Jonathan Badal]

All Our Ideas: /gsp10fee29jun

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as are available.

11:38

David Rose: Making connections.

Going from genetic sequencing.

Romer last night, putting a billion people in Australia.

Economic aspects of business and economies.

How robotics and stuff effects real world and gets to market.

I will try to speak slightly faster than I usually do so you can get lunch.

Lunch in upstate New York.

Crystal Bay. Near marina. Not built recently. Sitting in large industrial park.

Why?

Found picture showing same place with a whole lot of other buildings.

What was this?

Turned out it was once the world's largest yeast factory.

In the lifetime of my parents, was the biggest in the world.

Self-contained city. Own docks.

What is it that created this enormous company?

That made it disappear so only left is a restaurant.

Technological changes:

Outsourcing

Crowdsourcing ...

Offshoring

New way of business: Mass Collaboration.

Very different from 20th century.

Wikinomics.

What is the future of the company/firm.

Go backwards to see why they exist in the first place.

Adam Smith. Father of economic capitalism.

The invisible hand.

People acting on their own, guided by free market, will get things done.

If people do what they do:

fix

build

etc.

Then they do deals, would not need companies at all.

What changes that?

Why did companies get started?

Ronald Coase: The Nature of the Firm 1937 [ref]

Something has to get in there and futz (manipulate) with it.

That thing/person is the entrepreneur.

What are all the possible reasons to override freemarket.

1/ Some people like to work for someone else? No. Sub-optimize.

2/ Some people like being bosses.

3/ No one in business is sub-optimizing, it is consumers who want to pay more. [BRANDS?]

As technology specializes and scale and distance increaase complexity increases requiring more _____

If you are using a lot of people to do something, more-and-more people involved.

Can't just grow and sell rose.

You get transactions from people working together.

What are transactions?

What do you charge.

Make contracts.

Fixed price - what about risk, who takes that.

How are profits divided up. Things change - then what.

Catch to each is \"Cost\"

Every time 2 people get together - transaction costs.

As long as it is cheaper to do things yourself than do transactions, you will do it in house.

And your house will get bigger.

Ford - one thing in garage.

Another with factory.

you will not buy one tire each time you built one car.

You may want tire plant in your operation [vertical integration]

Therefore you will get larger and larger and larger

For that, Cose won Nobel Prize in 1991.

This is why firms grow.

Guy still at U of Chicago.

So Ford.

Scale up. Requires lots of components.

This is where it ends up. Rouge River Plant - one honking big plant.

100,000 people working here.

90 miles of its own railroad tracks and 30 miles of its own Roads

[JG: This was in my backyard growing up and let me tell you -- it STINKS - and is mostly a wasteland now]

Found out that paper was big external cost turned out transaction costs were cheaper to make their own paper to print their manuals to put into their cars

[Slide: IBM \"city\"]

1000s working there. Now gone.

Why?

Because, over half a century, it became cheaper to go back out.

Outsourcing.

When you get source and you have to go through large bureaucracy to do one thing you lose economy of scale, becomes better to outsource

Externalities in effect

A/ Cost

B/ Can do things better outside. Find innovation.

Angel investors rarely see IPO (Initial Public Offering). More often acquired = outsourcing of innovation.

You can outsource virtually anything these days.

IT

Human Resources

Facility - lease back

Manage real estate

Accountants

Tech support

Mfg

Overseas shops

Outsource your community management - on Twitter for you in India.

Outsourcing market now an enourmous number.

Example: local Conde Nast titles on news stand.

Garden Design magazine

One person produces entire magazine.

Outsources photos, writing, subscriptions, etc.

Now replaces what took hundreds before.

Example of a crowd source company:

Cable channels use this. Think of Space Aliens. Used to be like a film production.

Pond5 has 300,000 clips. You can upload, obtain picture, say, of Hangar 1

at NASA.

http://www.nasa.gov/centers/ames/home/2008/hangar_index.html

Put on a voice over and - without ever having a film crew or even a camera - a whole cable show.

Florists

National retail associations (FTD = Florists' Transworld Delivery?)

FTD clearance system

National phone retailers (1-800-Flowers)

National web retailers ()

Individual flower farms ()

/wiki/Florists'_Transworld_Delivery

Columbian florist will ship direct to you.

Using FedEx.

Decrease in external tranaction costs.

What is interesting is global scale.

Every company must think globally. You can not think locally.

You have to assume your business should be global.

Angelsoft.

Started with a global concept.

We are - today - this teeny-weeny company, leads the world in angel technology.

Spain coming.

World business association

50+

Suppliers can be anywhere, customers, etc.

Cloud computing - rack space at Amazon.

Design team

CFO

Research

HR

Sales

Anything you do you can outsource all this stuff

$154 B.

Tiny tiny companies -

Outsourcing = total global market of everything.

panjiva

Outsources everything. Takes data in. Knocks data together.

Find someone who makes pants.

Find reputation

Who they sell to

Are they specialized

That is for COMPANIES

For individuals,

personal assistants.

Freelance marketplace

http://www.j.gd/15901.html = Crowdspring --> logo, brochures

The crowdsourcing Process 8 steps:

1. company has a problem

2. Compnay broadcasts problem to crowd and asked for solutions

3. Online 'crowd' is asked to give solutions.

4. Crowd submits solutions

5. crowd vets solutions

6. company rewards winners

7. Company owns winning solutions

8. Company Profits

Wikinomics (3 years old)

Principles

- being open

- peering

- sharing

- acting globally

Put all the information about products on the net.

How many deals in last year.

How much time to deal.

So totally transparency and some of them are embarrassing, could take 3 weeks to 1 month to look at a deal.

Willling to open up, get people who know what they are getting as customers.

You know exactly what you are getting

Being open to peer to peer, sharing

The last ten deals have all been shared with other angel groups

Act globally, whatever you're doing, must look at a global level

Concept of FREE

What cannot be shared?

Virtually nothing

Jason was foudner of

/finance?q=NASDAQ:PCLN

Take the idea of globalize, sharing on national security

We have a big problem with lots of facilities and installations around the US that could be a potential target

But it's cheap with advancing technology, put cheap webcams on areas that should be no-man-land

take a shot every few seconds and outsource to crowd who looks for people in pictures

Do you see a person or vehicle in this image?

Options: Yes/No/Not sure

If someone sees a person more pictures are taken quickly and those pictures are crowd sourced until enough people say 'yes' and a security force is mobilized to intercept.

/article/218490/us-homeguard-someone-to-watch-over-you

\"Jay Walker, founder of , has moved from the auction business to the security business with US HomeGuard, an idea that would pay ordinary citizens $10 an hour to stare at surveillance video looking for terrorist activity.\"

Bob Rice - Three moves ahead

on Amazon: http://amzn.to/9lIBnA

Use heuristics like a human chess player in business to get great results, have solid ideas (protect queen, control corners and diagnals) and plan strategy around those

\"social networks will become profit networks as they are increasingly used to form jazz bands to attack specific tasks\"

The essence of entrepreneurial talent in the future

The ultimate entrepreneur of the future is someone who can pull talent around his area

Dave Brubeck

with your molecular structure, your talent

you should be able to form your own jazz band

Q: What DON'T you outsource.

One thing all this requires is the entrepreneur.

The unreasonable man. Shumpeter.

/wiki/Joseph_Schumpeter

Q: Would you invest in a company where everything was outsourced?

A: absolutely, Why inhouse when better outsourced?

Plenty of fish site in Canada. Was one person. Now 10. Multi-hundred dollar corporation.

[web ref] Free Online Dating at \u2122

100% Free online dating and matchmaking service for singles. 1300000 Daily Active Members.

/

Q: Everyone could copy your ideas if you're outsourcing them?

Keep constantly innovating. Pulling things together.

The entrepreneur must be flexible and must be constantly changing.

Q: Lifecycle shorter for outsourced business?

Hosting on amazon: nothing says it will be better hosted internally.

Just-in-time delivery/production

Can be left with infrastructure.

We are in a rapidly changing world - better to outsource.

Q: Back to crowdsourcing. Social and ethical implications. Crowd is unpaid, takes risks.

Issue raised with CrowdSpring. Less with

Are you exploiting people? Changing rules as Romer said.

Nothing wrong with working on spec.

Person is making the decision - time is worth it, on balance.

If Madison Avenue, $50,000 logo - you can't do it.

If your entire family's income is $50 / month - and you double your income. Not a negative.

Q: That's how architects work. One wins, rest waste several $1000.

I'm a market capitalist. Market will stabilize.

Scale whole thing. Look at economics.

Individual designers can sit on beach you saw in Paul's thing, that works.

Q: Pushing complexity - of simple tasks. What about complex tasks. Our company outsources, but there are always issues of quality and piecing things together.

True. We are in the middle of the curve. Now you are doing it. Challenges in quality and logistics. Reputation systems coming.

Pre-quality control

Outsourced project management

Mechanical Turk (again)

Anybody who needs something done - \"Is there a person in this photo\" to \"Review restaurant in Mountain View.\" Anyone can do it. Pay for it.

Social Mom. Backend platform. True blood story (again). Now on BluRay. Can connect to internet. Log in to Facebook account. It will tweet that you are watching and [yes, we know] it will make you look like a vampire in your photo. Sends your picture to MT to find two eyes and corner of mouth. They go \"beep beep beep\" and they get 25 cents.

Either bright 10 year old kid or someone somewhere far, far away in a distant land.

"

/core-Jun29-NCS-CL3

"Tuesday

6/29/2010

\"11:30 \u2013 12:30pm\"

Brad Templeton

NCS CL3 Network and Information

Slides: /slides/singu-security-priv.ppt

All Our Ideas: /gsp10ncscl3

10:52

Salim: We are getting started. Please grab your seats.

Student with a brief announcement.

: VECOY meeting tonight.

Salim: OK. Red/Green.

Brad: Green - if you agree.

Can just shout GOOAAAL if you need to.

Our teaching fellow is from Spain.

What technology is going to give us.

Jan: [picking up at slide 37]

About what happens with software in this new regime.

All the other cores sit idle.

Database servers have already been written to use lots of cores.

Parallel query plan for SQL.

Web servers all send queries - peel off and send each request to a core.

Emergence of services in the cloud - divide up computation, they divide up, massively parallel, will scale beautiful.

3D graphics, games.

iPad can do molecular renderings.

Another place working well - technical and high performance computing.

Libraries off the shelf.

With GPUs and clusters, that much more headroom - 10s of TFLOPS in you office.

How do we more the mainstream desktop software so it can take advantage.

When I worked on problem at Micorsoft - mission statement:

\"Provide loveable parallel programming models, tools, and infrastructure to enable any developer to write robust software that scales up on new hardware.\"

Matrix example.

Sort example. Divide and conquer algorithm. Recursive split - on a large piece of data to sort, we are willing to go 10 or 100 way parallel if that many cores are available.

Stream example. Should scale as more cores are provided.

None of these are robust - require shared memory.

Each says, \"It is OK with me if you run this. Promise of no concurrent access.\"

Dominant model. Shared memory. Locks control shared memory. Fine for experts in small teams. Not good for large software ecology. No data race flags.

Some experts will still go to shared memory, more isolated models will be transitioned to.

Amdahl's Law. Remaining serial parts will still be slow.

If just 10% serial, won't get more than 10x faster, regardless of number of cores.

Personal computer processing is \"bursty\" (comes in bursts)

If you are typing the processor is busy, if you are not, it is asleep.

Idea: functions put in libraries

Models for recursive decomposition problems.

Message passing models - works well at internet scale and also in memory.

Can have isolated processes that don't share memory. This model does not have the shared memory, data race pitfalls.

MatLab example - lots of array processing.

Parallel Legacy Software?

Ought to be a \"magic\" compiler.

Word has millions of lines of code with complex interactions.

Lot of investment in automatic parallelization tools, but only small point successes.

Serial dependencies - calling library - takes a lock, puts in a block - maybe yes maybe no.

Key press, mouse movement ... a lot of computation is done on that core thread.

Because there are so many layers - requires detangling single thread assumptions.

Better to just start over.

If companies chase new rainbows, reengineer stuff that is 20 years old.

More likely: compose new ???

Brad said emerging technology has demand question. Games, technical computing. Not superhuge markets compared to PC and phone markets.

\"My mom\" does not need TFLOPS. Extra $200 does not help her - until those applications emerge. [Open Allure???]

New software gobbles up hardware and brings it to its knees.

In summary:

End of rapid scaling. Still 10-15% per year.

Software that scales at this rapid rate will have to be written in parallel.

Software has to be more efficient.

Need to have systems performance-optimized to become more energy efficient.

\"I reduced the energy by a factor of 2 - giving more battery life.\"

Will give us new opportunities in the decade ahead.

11:19

Q: Matt: Feasibility of 3D printing for circuits.

Jan: Couple of things. 3D integrated circuits are FOR SURE the future.

Another memory company doing stacking for density.

Also difficulty of scaling lithography. Contact printing. Not sure how they make blank, but they impress -- just like old lithography -- get parallel rendering.

Brad: ????

Jan: Maybe. Still like photolithography myself.

Maybe 3D printing - I should have gone to the talk last night.

We do 5 - 10 layers now. So 3D would just be more layers.

FPGA's - like a reconfigurable computer - different sets of gates that you can build at home. \"It is equivalent to the rule that

Q: No home ..

Jan: My hobby is building processors at home.

You can do anything in the garage if you have the right garage.

FPGA - I want an AND gate to be the input of this thing.

They've gotten huge.

A billion gates.

You could build anything Intel did 10 years ago you can do at home.

In addition to hobbyists,

specialist processing for chess, DNA,

you get something much better than general purpose chip.

Closest to hobbyist computer design.

Also people doing printing - inkjet printer transistors ..

Q: Emiliano: Hardware guys doing their things. CUDA. OpenCL.

Software guys trying to build new languages.

In the middle, what is basically missing,

PicStream?

Rapid7

Anyone else in the middle.

What is problem matching up?

Jan: Computer architecture folks taking top down approach. What hardware do we need.

Much better than past. I know a cool structure, maybe some application would light it up.

Bit late to the party.

Can't tell you about any favorite software tool startups.

Best work in parallel tools is Intel.

They have Parallel Studio - addresses seveeral considerations. Finding races. Uncovering parallel opportuniteis.

In addition to commercial projects, teams working

APL?

Microsofts, Intels have a lot riding on parallel scaling up.

apple OpenCL

Grand Central Dispatch

Brad: One more. Connor will host talk to help. Maneul will also help define terms. Jan here Wed. And me.

Connor: 9pm. No overlap with HIV talk.

Parallel computing, optimizing energy. Leverage large distributed computer networks created by cell phones. Push computations to distributed network where energy is cheap.

Jan: Like peer-to-peer computing idea. Not so clear about all the cell phones in California.

Not digging the energy market idea. Interesting, but sceptical.

Brad: Alright. Thank you very much Jan.

[applause]

11:30

Brad Templeton - Computer Insecurity and Privacy

Slides: /slides/singu-security-priv.ppt

EFF /

Computer security sucks - yet we seem to be getting along

Most users are good, small num of bot nets and spammers

Automation automates both good and evil things

Firewall Hoax - like what we have at Nasa Ames

Isn't secure if laptops go into public places, get infected and then go back into their 'secure' homes or offices

Monoculture creates attractive targets, windows is so prevalent therefore most attacked

Liability for software makers won't work because one super virus will simple destroy the company

We haven't yet found how to incentivise greater security.

Bot Nets

Computer is secretly controlled by foreign user

30% of computers are botted

Primarily benign things like spamming

Most viciously used for DDOS (distributed denial of service) attack, could be used for extortion, costs about $8

Public Key Encryption - publish the key so everyone can encrpyt but only you can read, or everyone can read but only you can sign

- like a mails slot, creates a certificate/signature

- most comp security is based on keys

ZUI zero user interface - works so well no one knows it's going on. An example is Skype.

SSH - secure shell, used in command line, just works

SSL - it's a little involved to setup so 99% of web traffic is going on unencrypted wires

Example SSL Search - Google

\"With Google search over SSL, you can have an end-to-end encrypted search solution between your computer and Google. This secured channel helps protect your search terms and your search results pages from being intercepted by a third party. This provides you with a more secure and private search experience.

To use search over SSL, visit each time you perform a search. Note that only Google web search is available over SSL, so other search products like Google Images and Google Maps are not currently available over SSL. When you're searching over SSL, these properties may not appear in the left panel.\"

/support/websearch/bin/answer.py?answer=173733&hl=en

Phishing & Social Engineering:

/wiki/Phishing

/wiki/Social_engineering_(security)

A lot of hacking is social engineering, tricking people into giving you their passwords - (The Art of Deception by Kevin Mitnick)

A big reason 99% of traffic is not encrypted is because govt. made it a little hard to do and used weak encryptions

DES /wiki/Data_Encryption_Standard

WEP /wiki/Wired_Equivalent_Privacy

We'll learn more about quantum encryption which physics says is impossible to break

Some Topics:

Value of Privacy

Threats to Privacy

Now and in the future and other countries

Erasure of 4th amendment

Ease of use and user choice as negatives

Privacy is freedom.

When you are watched, you feel less free.

Heisenberg uncertainty

Observed that you couldn't observe a system without affecting it in the quantum physics world

A watched populace never boils

Apes (us) are the only ones who need privacy

Blinded By Science

Look hard enough in a big enpough sea of data; You will probably find whatever you're looking for; A seattle firefighter learned this the hard way; His house burnt down and his wife died; He was charged with arson and almost went to jail (because he bought a fire making chemical - for bbq - some time back), luckily the real arsonist was caught.

Scientists barely know this, juries definitely don't

You don't care about privacy until after it's invaded

You must protect others privacy to protect your own

There really is a slippery slope

We don't want to walk the edge of a police state

Shy people need privacy in a way that extroverts won't understand

Cloud applications

- Storing applications in the cloud - don't have to worry about distrtibuting it and making it cross platform complient and vairous individual settings on various systems

- Roaming, Scalability

[Slide of \"cloud\" - of atomic explosion!!!]

Pendulum effect

went from timesharing to pc back to timesharing (with clouds)

Consequences:

Data is leaving your hands

What we use to call spyware is now ubiquitous

You give up your right to refuse search and seizure when you give your data away like that, in effect you erase the 4th ammendment

We must be careful in not building the infrastructure of a police state

Don't intall the switch and make the question of freedom a policy question, by doing so you can have a police state without the tanks

e.g. Bush asking NSA which asked phone companies to tap the fiber optics due to terrorism without asking judges, later pardoned via POTUS working with congress

AI Privacy Invasion

- always been able to followable one person but now it's scalable to follow everyone and with AI we can have intelligent detectives following everyone

AI could judge us based on our past

- storage is cheap and laws change

- \"are you or have you ever been ...\"

Somewhere in the world governments will use facebook to roundup groups of people

- Don't facilitate big brothers

/wiki/Expectation_of_privacy

China has pushed the Police State button.

/wiki/NSA_warrantless_surveillance_controversy

Whole new level of privacy invasion coming with AI.

AI will have better ability to recognize faces, voices, will learn a lot of stuff.

Scalability is the key to everything.

Always been possible to follow people. It costs money.

Usually we mean it scales linearly.

Computers can do things a MILLION times more.

With AI, you can follow everyone with a \"Sam Spade\" (fictional detective)

/wiki/Sam_Spade

ATM recorded your visit with a webcam.

AIs will scan the past, punish you for sins of the future.

Not only what is the threat today, but what can the future do - reaching back to hurt us.

/wiki/Falun_Gong

What if Chinese Falun Gong followers had been on Facebook?

We do not want to be the preferred vendor for Big Brother (reference to Orwell 1984: /wiki/Nineteen_Eighty-Four )

Traditionally we have had a balance.

We are changing that balance. Think about it.

Ease of Use is a Bug

Magnetic stripe on a license is an easy way to transer info

Before long web forms made you never want to join a website,

Facebook made it easy to share private info with fb apps

Must consider the impact on privacy and policies caused by these accelerating technologies

BEPSI: Bulk Export of Personal and Sensitive Information.

/rename-data-portability-bepsi

Q: Alison: RFID -

/wiki/Radio-frequency_identification

Brad: chip in your passport. No battery, powered by radio burst.

Can't check into hotel without showing your passport. May contain health data.

Can be read from 3 feet away.

Q: Sasha.Privacy Insurance.

Brad: About calcluating risk. Don't know enough.

Privacy insurance:/community/node/26132

Q: /France: Give prints at border. Took passport and tested it to see if it was fake.

Brad: At border, they can do unconstitutional things to you.

Q: National Security issues.

Brad: They don't inform us. Aware that security in the US is in terrible shape.

Idea that there might be a cyber attack.

Would like to have the internet privately owned. The way it is now.

Q: Steve Cronnin from the US. Looking forward 20 years, if government is capable of misuse. What protections can be put in?

Brad: Sceptical.

Proposal - number working on same philosophy. Own personal cloud. Like a safety deposit. Code comes to data rather than data coming to the code.

Google does not want to destroy value of data.

In Europe, there are laws on data retention. Some FORCE retention. Other laws FORBID retention.

doing everything with one company is monoculture.

I like Google a lot, but there are negatives.

Q: Even good intentions at corporate level doesn't stop one employee who could access data. Censorship in China.

Brad: They (Google) found China used their control to attack (dissidents).

Q: Rosa: Stockholders. Information is most valuable asset.

Google interesting in that way: give stockholders less power, keep it with founders.

You are trusting the founders of Google.

Q: Candice of Canada. Global privacy. International privacy push? Like human rights.

Unfortunately, anti-privacy push. [needs better link here]

/wiki/Anti-piracy

Q: People who want access.

Brad: A little bit. Not up on digital rights stuff.

Q: David H/NZ: Next revolution DNA knowledge. People give up privacy out of complacency or information overload. What if there are values to it?

Brad: I asked for people who design these policies to make conscious choices.

I just want people to not go gung-ho and not consider the balance.

Q: Eric. Singularity coming. Know everything about everyone else. My DNA. My data. Just someone who wants to know it can do it.

Brad: Lot more surveillance that could be done.

Recommended the Book: David Brin, Transparent Society. Is on shelf from Smart.

/wiki/The_Transparent_Society

Sarah: Anti-sedition act as knee-jerk reaction to war on terror. Cleared within a week. Public expression that questions government in any way was seditious.

Brad: Why didn't they fix it?

Sarah: New privacy laws for system which are almost as strict as Chinese government. We are blocked from speaking out against this privacy law. Orignially for children's rights. .(/) Global organization to protect imprisoned bloggers. Will go in, if someone is arrested.

No independent voice. The threat of hive logic is so overwhelming.

Brad: AUS has great vision of freedom. Many did things equally bad. US had Patriot Act.

/wiki/Patriot_Act

AUS has net filtering law

/wiki/Internet_censorship_in_Australia

Q: Julielynn Wong: Canada/US. Is security of personal health information an illusion.

HIPPA is about security.

/wiki/HIPPA

Have access to your health data but let the storage be owned by YOU not by a company storing it for you. We need to find a halfway between the PC we have and the CLOUD we are going to.

When databases are built, they have a job of saying, \"what can we do that is interesting\" and \"how can we make money.\"

If the company gives stuff free - the exchange is they get data to make money.

There is a pony in there (US joke reference: / )

Q: Eugenie/France:

Brad: May deliberately set up system with no access.

Every attempt to anonymize data, can be de-anonymized because there are things in there to figure out who is who. Google's removing last octet is not enough.

Afternoon off.

Salim: As you can see, we have a fascinating set of discussions ahead of us.

Brad: Google thing tomorrow.

Salim: Justina is a postdoc at harvard.

Justina: personalized systems. From GSP09.

Em: camera lost

Day/afternoon off. Bus wil leave at 583C. to Shoreline park. Trails. Biking trails - we can borrow bikes. Frisbees/ toys. Til 5:30.

For the evening - another session sponsored by FEE track. Paul Roemer.

Other announcements.

For cards, please keep them in your badge holder.

Feedback for lecturers - already up in GSP10 portal. You can do that.

Another petition for opening up the gym.

Petition sheet in 583C.

Jose? Marathon.

1/ Organizing energy trip for one of two nuclear fusion. Other in france. We need 45 days of clearance. I need your signature.

2/ Etherpad for marathon: /sfmarathon

Q: Chiara. Gym = swimming pool.

Same people.

Brad: John Gage and I still working on track. I live in Silicon Valley .. if you say, \"my god, if we could go there ...\"

Salim: Two last things- camera - you guys are absent minded people! Great to have revolving policy. Going crazy with submissions.

[showing of Etherpad video]

[End of presentation]

All Our Ideas: /gsp10ncscl3

"

/core-Jun30-FSF

"Thursday

7/1/2010

11:30-12:30

Paul Saffo

FSF CL Cultivating intuition: effective forecasting in the face of rapid change

Slides:

Kathryn will review later looking for any [ref] markers--She and TFs will fill these in with references, but all are welcome (encouraged) to add references / put in as many details as available.

11:32

Paul Saffo - responsible for Futures Track here.

Smaller than last year.

Difference between catholics and congregationalists.

Catholics go to heaven. Congregationalists go to a meeting about going to heaven.

Entire summer for you is exercise in forecasting.

You have domain experts who are forecast minded.

In that spirit -

I teach forecasting to engineers. Have been here for 25 years in Silicon Valley.

I have outlived my own forecasts.

Just started a new company. Caught enterpreneurial disease from Peter.

Having the luxury of all these experts. Talking about specifics. What are the (heuristics) methods I use.

Forecasting Methods

Navigating uncertainty \u2013 effective forecasting in an uncertain time

[Slide CNN Hunt for Bin Laden. Experts agree leader is dead or alive.]

Very good forecast.

Reminds you of that lament: one armed economist,

I would wish for a one armed econoomist because they say, \"one the one hand ... on the other hand\"

Essence of forecasting is to embrace uncertainty

When facing uncertain situation, don't pretend there is no uncertainty just because it makes you feel uncomfortable.

Learn to live with uncertainty

Thus this is how I think of forcasting

You are thinking of an event and you can draw out the outcomes, not unlike a forcaster thinking about a hurricane's path, the same is done with technology

the cone going out from the event is narrow but it gets wider with time

Forcasting is not only difficult it is logically impossible, the fact is that the uncertainty behind forcasting is intrensic

I think that's good news

of course if we could get a peak into the futre, why bother

The bottom line behind why ones forecast is to get a range of possible outcomes and what can one do in the present to make the most agreeable choice happen

As you thinks of future lectures and team projects, always assume you're wrong. Forcast often and repeatedly. The interest is finding a cone that has balance, not too narrow not too wide

Try not to miss possiblities. Identify the key driving factors.

What are the driving forces underlying the thing that you are looking at that and are going to have the biggest factors in driving its change.

Jim Dater U of HI [ref]

Three kinds

*Continuations

*Cycles

*Novelties.

Constants:

Moore's Law. Predictable rate, we take for granted.

Imagine if \"will stall\" we'll be stuck with Windows 7 forever.

Usually the bulk of what is happening. We tend to miss because we take them for granted.

Continuations - identify them and make sure you identify all of them

Cycles:

Not here today, was yesterday, will be tomorrow.

Sun spots - starting cycle 24.

Kondratiev wave [ref]

In 1925 . Super cycles.

Only detail - it can be dangerous being a forecaster. Made Stalin very unhappy.

K died in a gulag in 1948.

Sometimes just tell boss what he wants to konw.

prosperity, recession, depression, improvement wave

We REALLY overlook the novelties. No frame of reference with which to measure it.

G basketball video. Don't tell - you miss the obvious.

Our perception causes us to miss things that are completely new

The mother of all novelties in 2008/9 not sure exactly when it happened human population is majority Urban.

In the 10,000 years since we started building this planet it never happened

Not like it never happened Lately - it neer happened AT ALL. Could have huge impact.

Was just a little blurb in teh news.

Dig underneath it = over 1 bn urban dwellers live in jury-rigged houses on land they don't own.

Hmmm maybe that's a novelty that could have a very big impact.

Once you've identified driving forces, look for Cross-Impact.

Rarely will one driving force be alone, look at more than one things coming together

Interaction among driving forces.

Cross impacts.

Take forecast of global population - humans can't grow exponentially foreever.

Inflection point due to urbanization.

Can we build livable cities or will we have a global slum.

Or does it become the global slumHam operators? Sun spot cycle example HF care, rest should as well. If really bad, our computers might not work.

Devices sensitive to electromagnetic pulses.

Sun spots may be a lot more relevant.

Scenarios - plural. If just one, it is not a scenario.

Explore options

look at different options

Back of envelope coctail party to million dollar study.

Multiple possilbe outcomes.

They way to integrate these all together is scenarios. The whole point is to explore and look at many different outcomes.

Here is how I approach it at its essence.

A scenario forces you to look at all the possibilites, cross impacts

Singularity

It is coming.

Hmmm. Are we sure?

What are the driving forces?

Tech change.

Other axis. What could I choose.

Public accpetance is assumed. - Maybe tehy won't accept it.

Four squares you can fill in.

Graph of Innovation Rate (stagnation to acceleration) vs. Public Acceptance (low to high)

I find 2 dim is enough. No compute rsoftware required.

High inv rate, public loves it. K's duet.

Shorthand for celebrating 150th birthday, playing piano duet with his late father who is present as an AI.

Come up with snappy titles - otherwise it blends into gray goo.

Singularity? What Singularity?

Just like space program. Went to moon. Expected Mars. Now \"pissing around in low earth orbit\" you can lean out the window of ISS and trail your fingers through the atmosphere.

Only geeks care about space today.

Rest of world could care less.

Not WORST possible - one step further.

Fast growth in tech and people gets scared. Mad as hell.

Remembe what happened to Knod

Public comes after you at night with flaming torches.

Final square:

Tech stagnates, but public buys in.

Desperately Seeking Singularities - people get mad. We counted on you to save the world an dyou failed us. Won't buy stock in your company.

So now let me ask you a quick question:

Show of hands. Who thinks which is most likely.

Other state?

Don't take your scenarios too seriously.

General public will not see what is coming.

you will confuse desired future with actual future.

You have to engage in Active Cognitive Dissonance to see alternatives.

The other reason to use scenarios is there is a

Big difference between forecast and reality.

Reality does not have to be \"believable\"

You see guys with a kite. They fly in it. suddenly people predicted personal flight.

Orville says, \"No. Never will happen. Only insane hobbyists wil have that. Instead, we will all fly around with aluminum cylinders with 100s of people and they will be unhappy when they are 30 minutes late.\" He would have been locked up.

Wing span is longer of entire flight of Wright brothers in 1903.

Think of Wildcards. Extend and test your scenarios.

Probe outer end of that cone of uncertainty.

Nothing is ever certain. 2012 Maya prophecy [ref]

Even, not knowing that, omit.

Unlikely things - reality has way of making unlikely come to pass.

Other contexts - things can become drivers.

You may feel an earthquake. USGS has done studies.

I have a high precision point on my property. It is moving 2 1/3 inches a year to the NW.

62% chance of quake.

Wildcard - magnitude 7 quake behind now and lunch.

If it hit, we've got the big one.

Driving forces can be wildcards if put in a specific time frame.

You know all about ...

from Ray's book.

Flat spot on left - pay close attention

We are linear thinkers. Very hard to forecast.

This tends to be what happens with visionaries.

They have such clear sight, they draw a straight line.

Early lesson I learned.

Never mistake a clear view for a short distance.

Entrepreneurs constantly do this.

Overestimate short term, underestimate long term.

People walk away just as business is taking off.

This can be very powerful tool for inflection point spotting.

What's going to be the next big hit? Look for something that has been failing for 20 years.

Rule of thumb 1: CHERISH FAILURE -especially if it is someone else's failure.

S curves apply to more than just tech

It can also apply to things like exploration of the new worl by europeans

Where did Columbus fall on this curve he was not at the turning point, he wasn't the first there, the first to make it back

Columbus came back when geo political environment was just right

Timing is everything

In biology innvoation is mutation and generally only happens when organism is under stress.

It's a very risky maneuver, Innovation (mutation) is generally lethal.

Habitat was an early Second Life

Rule of thumb 2: Indicators precede inflections (and the stranger the better)

1. contradictions - gold and google stock example Oct. 2007 vs Nov 2008

2. inversions - drug cartel cops example

3. oddities - roomba and DARPA grand challenge example

When times are bad gold is high stocks are low, when good stocks are high gold is low but mid 2007 - early 2008 both were high and it scared me

Rule of thumb 3: When change clusters at the extremes ... much more change is coming

Sure enough the economy tanked

Inversion of cops in hiding while criminal is proud in front of the camera, inversions happen all the time

When super wealthy is saying the roomba changed her life, people are naming bots and taking them on vacation, that was an inflection of robots making a big impact

Darpa Grand Challenge 1 - non completed, furthest got 7 miles, race was 150 miles

Darpa Grand Challenge 2 (one year later) - 5 completed the race

Reaching inflection point

Pile up of hundreds of cars north of Darpa challenge on the same day - people shouldn't drive!!

A new technology arrives and sit sets the space for innovation, for the take off of an ensuing innovation.

micro processor leads to PC

lasers lead to communication access/world wide web

sensor technology leads to interaction and robots \x3c- the next big thing

If you are going to look forward look back as well

Technological Ages

1. Chemistry - ealry 1900s

2. Physics - 1930s

3. Electronics - 1960s

4. Biology - 2000s

every technology works off each other incrementally

as you are moving forward think about these longer slower fields

What can you get a date with at a cocktail party?

Tip Jar: If you fear change, leave it in here

Embrace Uncertainty! But keep in mind you will scare everyone around you.

paul@

[end of presentation]

Watch 2 minute Tech Update on YouTube:

/watch?v=EyNBZMjz2QU

on SU video server:

/#/Play/contentId=12569090359a5e04

=================================================================

Question Template [for copy/paste - do not use]

Vote by adding +XX where XX are your initials (see key: /initials)

Student Question:

Student Votes:

Student Comments:

Faculty Response:

=================================================================

Student Question: /essays/disinteremediation.php says value chains are getting longer, not shorter. This came up yesterday for me as I looked at bicycle sharing which has become successful due to an ADVERTISING company. What other examples / opportunities for longer value chains do you see?

Student Votes: +JG

Student Comments:

Faculty Response:

Student Question: What comes after bio?

Student Votes:

Student Comments:

Faculty Response: Perhaps nano, even though that's combined with bio

History of technology. More control over smaller stuff.

Nano.

Student Question: Black Swan [ref] How have you dealt with that in forecasting?

Student Votes:

Student Comments:

Faculty Response:

An indicator, read book. Nice meditation on how unlikely events can be much more likely.

Lebanon was place he learned to expect unexpected.

Systems susceptable to

Let me recommend:

AI Track. You've got to read this. Software robots here already. Scarry consequences of bots. Daemon by Daniel Suarez.

/

Student Question: What things are people excited about that probably won't pan out anytime soon?

Student Votes:

Student Comments:

Faculty Response:

Has anybody taken a Roomba apart? There probably won't be a all-in-one AI robot anytime soon

It is just a pile of transistors. It is an imposter.

Vision of intelligences smarter than us ...

Most of our friends can't pass the turing test.

Good news . it is probably far off. If we are very lucky, they will treat us like pets. If we are unlucky, they will treat us as food.

Student Question: Backcasting. Merge with forecasting

Eric Eze: Backcasting: /wiki/Backcasting

Eric Eze: backcasting 2: /the-system-conditions

Student Votes:

Student Comments:

Faculty Response:

Start wtih preferred future. Work back. Very powerful tool.

Thanks for mentioning.

[applause]

Salim: Couple of announcements.

Different format to try more interaction/discussion. We'll try that out.

Bus to Google -your name has to be on the list for you to go.

Yoga and basketball and boot camp tonight.

Canoe and beer for Canada night.

Instant Evaluation:

/gsp10/feedback/week-2

"

/core-Jun29-NCS-CL2

"Tuesday

6/29/2010

10:15 \u2013 11:15

Jan Gray

NCS CL2 Network and Information

Moores Law: The Marvelous MOSFET, see slides with image.

Notes were just put at the end of the /core-Jun29-NCS-CL1 pad.

Jan:

Slides at /leaf?id=0B6vjqTaW5opaYWU0MWJlODctZWQzZi00MTk1LThiN2UtZDlkODNjMWMwODAw&sort=name&layout=list&pid=0B2Ij9HPeinaFODJjNjVlYTItNTlhMC00YzI0LWFlZDEtM2U3NTg3ODc5OTNj&cindex=1

I was born when Moore's Law was framed. Hope it will keep scaling up.

Around 2004, ebb in performance scaling. Run from 1970 to 2000. Doubling every 2 years.

1 MHz to 3000.

Each clock cycle did more.

Heat disappated went up.

Rounding off of clock speed: 3 GHz

Yet we've gone from 10,000s to millions of transistors on a die.

do we have a good c?

architectures - how to spend them?

How does software change?

Some electronics. MOSFET

Transistor is three terminal device. Source, drain. Control gate.

Channel has semi-conductor material.

If NO voltage, channel doesn't conduct.

If positive voltage, you get conduction from source to drain.

[Video - sand to silicon chip]

Make one large silicon crystal.

Slice it.

Photolithography.

A resist. Expose through mask with many many copies on round wafer.

Etch, deposit.

Build parts of transistor - 9 layers of metal.

100s of saws cut it up.

Several hundred billion transistors on that one die.

[Chart from S. Borkar]

Each 2 years, we go into a new technology Node. Smaller by 0.7x. Doubling in 2 year.

Quadrupling of transistors on a die.

Quarter of a trillion transistors on a die by 2018.

Rate of speed improvement is going down. Not as well as they used to.

Then it will slow down to every three years after that

Extend 193nm refractive lithography

Optical proximity correction, double patterning

13nm EUV lithography

soft x-rays, vacuum chambers

Transistors:

new material in gate, insulator, channel

DRAM - capacitor, 2x/3y

FLASH PROM - floating gate 2x/1.5y 64gb at 25nm

3d: stack cells vertically

resistance change/phase change RAM

amorphous/cystalline

Slowing of transistor doublings (now we are 2x in 3yr)

But.. cost halvings still continuing - \"22nm ought to be enough for anybody\"

Computer Architecture

1986-2002, computers 2x in speed every year but now its leveling off

Instruction Level Parallelism (ILP) [cut and paste from slides]

Spending Transistors on Performance - run programs 2x as fast

L1 cache reduces memory access time

Branch prediction for determining where the program is heading

Vector operations FPU's for working with videos/graphics

Over 30 years - CPU cycle time 1000ns -> 0.3ns but DRAM access time 500ns -> 100ns

sometimes progress stops for hundreds of nanoseconds

\"The Power Wall\"

Over last 30 years: die size larger, voltage 15->1v, frequency 1->300MHz, Power 1->100W

like the heat of a rocket at 1000x and surface of the sun at 10000x, just can't go there

P porportional to CV^2f

the power wall is the limiting design constraint

\"Complexity Wall\"

diminishing returns in wide-issue machines

only a tiny part of the die is actually doing processes

\"Explicit Parallelism - Multi-Core\"

much more area efficient

power wall is still there, how to solve?

finesse power with lower V, lower frequency, sleeping of transistors

finesse memory wall with memory parallelism

can't think of anything better so let's see if we can get the programers to get it to work

32 cores = 1 trillion floating points per second

Single-Chip Cloud - 48 individual cores

\"Scaling Up Memory Bandwidth\"

TFLOPS need TB/s of data.... 100s of GB/s not nearly enough

solution: bumping, die stacking

\"Silicon Photonics\"

should surpass copper traces for non-local interconnect

optical links at TB speed

Die stacking + Photonics = adequate bandwidth for next generation

\"Graphics Processor Computing\"

100s of cores

1000s of threads

Graphics module is very accessible to scientific and technical computing.

GPU use is still \"black magic\"

Game enthusiasts buy $500 boards and drive supercomputing.

Nvidia chip with 500 cores.

/content/global/global.php

/object/cool_stuff.html

Systems on Chip, Network on Chip, Modularity, Heterogeneity

database with large cores, small cores, media cores etc... mix and match for different problem domains

After 2015, a lot more fault detection on chips

Eventually to the point that computers are modular/stackable

iPhone G4, optimized for low energy

Eurocloud - research project that makes 3D cloud computing on a chip

Break at 10:26

Brad: I hope this was good. [Green and red card votes.]

Building a chip today is like trying to paint art with a paint roller

Connor: SU exponential technologies. Age of abundance.

How will computer design / chip /datacenter design when energy is limitless.

Jan: All large scale production systems will be expensive, hard to deploy. Don't know where ..

IF we had unlimited energy, constraints would go away until planet melts down.

Brad: Unless we come up with technologies, like reversible computing.

They get as hot as surface of the sun.

Jan: We'll just use lasers to put energy in space.

Brad: Or put computing in space. [Dmitry?]

Eric: Glass revolution. Explain a bit more. People-to-people.

Brad: In English, Grass roots is something coming from bottom.

Markets have exponential growth. If networking is done at grass roots, connecting neighbors with Gigabit.

Like Wi-Fi - always a hotspot somewhere near you.

Sometimes give away free.

Revolution of access.

Take that model so you can go to local electronics store.

Fibre is safe.

Not worth stealing - unlike valuable copper.

Sends immense amount of data that does not involve phone companies.

[applause]

: Wondering about cloud. What is next?

Brad: Stratosphere. Proposal to put computers in space. Actually latency to LEO is quite good. As good as using something on your desk.

Other proposals - quantum computing next week.

Strange rules of quantum physics to do computing in small groups of atoms.

May still have clouds of quantum computers.

That will stick around.

Jan: 50x or 100x cost reduction of processors in the cloud.

Brad: Buy computer today, run for 3 years. What is most expensive part:

The ELECTRICITY.

Not fixing that well right now.

Home energy track may address this.

Dmitry: Vacuum of space? Cold? Problems.

Brad: Only cool by radiation. Not so good.

Dan Berry- when they take laptops into space, they must put fans on them because cooling does not happen by convection in AIR.

: So the cloud is built and operated by companies at the moment. Should it be?

Brad: Next session.

Brad (GSP Brad):

Jan: PhysX - software physics interface. Discontinued ?agea?

Now in GPU. Gathered they felt scaling of GPU did Physics stuff without using 2 chips.

Sarah/ Australia: Potentials for supercomputing involving biological systems? Interfaces?

Jan: Lovely image of chip + neuron.

Inspired architectures - neocortex type in hardware, very interesting.

Brad: DNA computing?

Very slow, but for free, DNA will grow and may come out with calculation.

Jan: Biological curcuits. DNA has nice property of complementary base pairs. Some parts of the strand bind tightly. Others left dangling. You can do AND gates. Strand activates whole other computation.

Not aiming for TFLOPS. Rather simple computation to unlock drug at particular site.

Kind of taking experience with computers and getting state, amplification in DNA strands.

Sky is the limit on what you could do with this.

Brad: You guys have been very interactive.

Tony / Korea: End of Moore's Law? Society is depending on it - some industries would close? Implications of plateau?

Jan: Every technology has one of these cycles. Fortunate technologies go through phases, slow down, turn to new technology.

Theme of this talk - uni-processor slowed, however with more cores - with parallel software we should get back to fast rate of scaling.

Not stopped growing - still getting 10-15% better. That is amazing.

We will either transition to something else or cheaper ...

Brad: Pause now. Come back in 7-8 minutes.

10:43

NEW PAD AFTER BREAK:

/core-Jun29-NCS-CL3

"

/core-Jul13-SPS

"7/13/2010

Tuesday

9:00 - 10:00 am

SPS CL1 . Exploration of Mars (Pete Worden)

Slides: /fileview?id=0B2Ij9HPeinaFOGEwYmExODktZTAyOC00Y2E3LWFiM2QtYzZmODI4ZWZlYzgz&hl=en

10:15 \u2013 11:15 am

SPS CL3 Outward from Earth (Chris McKay)

Slides: /present/view?id=0AWIj9HPeinaFZGY2cDNjOXpfNDQ3ZGI4anYyZ2M&hl=en

11:30 \u2013 12:30 pm

SPS CL2 Rocket Equation (Dan Barry)

(outdoors

9:10

NASA does three things.

1/ Science. Has been exciting decade. We don't know hardly anything about the universe. That's called job security.

2/ We do a lot of stuff to help life on Earth. Climate change. Revolutionize green aviation. Carbon neutral, eventually carbon free air travel.

3/ Human space flight. Objective is to begin settling the solar system.

What we are doing. Where we might go.

- Virgle. The Adventure of Many Lifetimes

/virgle/

Joint venture between Virgin and Google called Virgle

On April 1st, but may not be a joke.

- Settling Mars

Most likely place for permament human habitat is Mars

Typically interesting part of mars is below the surface

Keys to settling mars or anywhere else

1. In-Situ resource utilization

2. stepping stones via asteroids

3. one way? \"president doesn't agree but I do\"

- Mars Surface - Showing crater with ice

Mars: It's Big, pretty dead world

Surface is volatile and rich

- Potential aquifers under the soil

- Methane on mars suggests potential life processes

Life on Earth could have come from panspermia, asteroids from Mars containing life

/wiki/Panspermia

Near-Earth asteroids may be a good stepping stone for getting to Mars

-Known (current) NEO Population

There are thousands of these things that are easily accessible

http://www.cfa.harvard.edu/iau/lists/InnerPlot2.html

- Asteroid Itokawa

1/2 kilometer, typical asteroid between earth and mars

- Asteroid and Comets visited to date

Itokawa is just a dot compared to other asteroids

Composition ranges from almost pure metal to ices and other volatiles( bodes for life)

- NASA's exploration lauch architecture

Saturn 5 used for apollo missions, replaced with shuttle that turned out to be not so cheap

Underfunded by 50% - 200%

- NEO missions

-

Easier to go to an asteroid than it is to go to the lunar surface

Moon has about 1/6 gravity but asteroids are much smaller and have essentially no gravity

- 5 month mission to a near earth asteroid

- Exporation Metro Map

If were going o go to a lot of places in the solar system why not build something that can do that

A space metro system

Build sstems that can go to asteroids, mars, outer planets and equilibrium points between objects

/wiki/Delta-v

- We want to turn low earth orbit travel to private sector

Later in the decade want missions to get to the moon

Build the first true space ship

Next step would be getting to equilbriums and space walks near these objects

Final step is to Mars

- Reusability and Advanced systems

using 'ion' drives

-Stepping stones strategy

moon and lunar robotics, deep space, asteroids, moons of mars, mars, ...

-

get to main belt in next [?] years

- Asteroids

building blocks of solar system

overtime collided and coalesced into planets

/wiki/Tunguska_event

-

Nasa Ames is getting half a billion with DOD to create space ship [SPE?]

- Mars has two moons Phobos and Deimos

why to phobos? may contain volatile surface, raditation safe haven, can use robotics, good staging ground

-

-

Itokawa is prbbly, others are smooth, shows differences we need to do spectrography

- LCROSS \"bombing\" the moon

I twittered \"Nasa Ames is go for first bombing run of the moon\" got some conspiracy theorists worried and leadership told me to shut up

\"NASA Bombing of the Moon may create conflict with ET's, UFO's\"

http://macedoniaonline.eu/content/view/7216/56/

Cost 78 million dollars, pretty good mission

-

- Benefits of Commercialization

Falcon 9 launch in June, first rocket feveloped in US in a long time completely with private funding

-

Photo of illuminated via natural illuminescence cyano bacteria, one of the oldest organisms we know, helpd to create an oxygen atmosphere

-

- Biology beat checmicals and physical methods for food production

Cyanobacteria spirullina

- Craig Venter

\"Over the next 20 years, synthetic genomics is going to become the standard for building anything\"

- Applications of synthetic biology to NASA

- Pharmasat -1

http://tia.arc.nasa.gov/pharmasat/

On Twitter: /PharmaSat/lists/memberships

- Harabusa NEO and Tagish Lake Meteorite

/wiki/Tagish_lake_meteorite

- meteor is about 30% volatiles, looks like coal, can we grow cyanobacteria on these

/wiki/Cyanobacteria

-

-Deimos and Phobos

Orbits are very close to mars, makes a fairly good space station for telerobotic exploration of mars

- Life on Mars?

say what we thought was fossilzed bacteria on asteroids but much smaller than any bacteria on Earth

- War of thw Worlds

Life is a scary thing, let's make sure there's none before we do any drilling

- Places in space for life

Meteors and Asteroids, Craters with Ice, Mars

- Terraforming Mars?

seems life the possibility is there

very interesting prospect

- Other target opportunities

-

Paper says there could be life on mars or Titan due to methane

-

Other worlds with liquids, Mars, Europa, Enceladus, Titan

-

Keplar, first device primarily used for finding earth like objects

we now have 6 months worth of data with about 20 candidate planets but there are other factors

-

Possilbe to find Pandora like moons

/wiki/Polyphemus

-

Close with a few words on private funding settlement

/wiki/Mayflower (didn't go so well)

- Pick of pilgrims

it's a serious issue

-

There are caves on Mars that could be potentially sealed and could be used to create earthlike conditions and atmosphere

-

Nasa toyed with idea of selling space but didn't go far

-

Now more progress is being made in commercial sector

-

In conclusion

1. We will soon have ability to visit Mars and other places in Solar System

2. Settlement is the only rationale for human space travel

3. Path to Mars could be via near earth asteroids and Phobos

4. Use bio-engineeed tech to make what we need

5. Private one-way setllement missions could occur soon

Q: With everything moving in space how much do launch windows affect these missions?

A: Does make a difference but not that much ???

Q. How well are space technologies being deployed on Earth?

A: Use to be good at this but not anymore, Nasa just doesn't have much better tech than private sector now

Technology Development and Infusion from NASA's Innovative Partnerships Program

Douglas A. Comstock

National Aeronautics and Space Administration

http://www.nasa.gov/pdf/324711main_ieeeac_paper_138.pdf

Q: What are the reasons that private rockets are cheaper now?

A: NASA had a lot of money and maybe Elon Musk

/wiki/Elon_Musk

did use/steal previous work but so what? Highlights the efficiency of privately funded lean and narrow focused endeavors.

http://nasajobs.nasa.gov/

Invited to NASA bar and golf course.

10:04 [applause]

10:16 Chris McKay

-

Astrobiolgy is the study of the origin, evolution, distribution, and future of life in the universe

The future involves human choice and actions

-

I want to propose an answer to the question: why do we care?

-

-

Whiy is Mars useful for human exploration

1. Did Mars have a past in terms of life?

no role for humans here

2. Can Mars support life?

involves humans

3. Can Mars have a biologiical future

our decision

-

Don't send humans because they will contaminate Mars before we can determine it's own potential for life

-

True story, on July 4th 1997 we sent bacteria to Mars, they came unarmed and peacefully

Most died

They were dormant on the landing craft

Pathfinder

-

After Viking we stopped sterilzing landers

We know where the contamination is, we know where the parachute, heat shield and lander are

-

-

Death on Mars from UV light means that bacteria can't live on surface, we could remove contamination by cleaning up pieces

-

Rabbit removal from antartica vs. australia is linear vs. exponential for same reasons of harsh environment

-

Three possibilities for Past life on mars

1. No life, no worries

2. Common origin of Earth life, very little worries

3. It was a second genesis unrelated to Earth, true aliens, could be worries

-

Tree of life, all life is just one biochemistry, aliens could potentially not be on our tree of life

Assigning Moral Status:

- Moral Agents are rational,

- Moral Status, we humans assign moral status

Pain, complex behavior & communication, or membership in a set.

Set theory example: being human (if your not rational, you have same moral status as rational humans, just for being a member of a set)

2 sets we assign moral status: life and sets

-

Moral Status of Alien Microbes,

Argue that microbes score moral status on pain and ect.. but high moral status for life 2.0.

-

Argue we need to biological reverse exploration.

Drilling below the surface could lead to non-reversible bio contamination

-

-

We should have bio-reversible \"ctrl Z\" option

ok/cancel prompt: \"Are you sure you want to drill into thes subsurface Martian aquifer?\"

-

-

Do you notice the difference between these two pictures?

- Long term view of beinging Mars back to life, terraforming, Water may have been a marble, now is dry, maybe will be again in the future

Don't have all the components for life but Building blocks are there we just have to assemble them

-

Terraforming mars is live a descent down a high mountain

-

How do we warm it up? Use greenhouse gases other than chlorine and bromine

There is no meaningful difference between life and nature on earth. But in Mars there is no life, so do we value nature or life?

1990 McKay, tried to evaluate ethics independant of life on earth. (see slide)

My adding life, we can add it some sort of intrensic value.

Takes actions of Deep Ecology (Naess, 1984) as true, then

Deep Ecology:

There is inherit value in life, the more wide spread and diverse the life the more valuable.

Our goal on Mars is to enhance and enrich life in the universe.Deep Ecology:

There is inherit value in life, the more wide spread and diverse the life the more valuable.

Our goal on Mars is to enhance and enrich life in the universe.

Q: What about extremophiles

/wiki/Extremophile

A: unique in location but not in DNA

11:03 [applause]

Dan: Next lecture by building 20.

Em: Announcement - badges.

=============== POST-presentation notes

Instant Evaluation:

/gsp10/feedback/week-4

/viewform?formkey=dGZadGpDejljY0JaWnRnV2Q1SEdYRGc6MQ

"

/core-Jul12-AIR

"

7/12/2010

Monday

9am - 10am

AIR CL7 AI Agents and Assistants

Adam Cheyer

Where: Ballroom (B3)

Slides: /news.html (actually, link is broken ...)

Slides in ZIP file: http://bit.ly/aTOZRt

10:15 Dan Barry

AIR CL8 Robots in the Real World (Dan Barry)

Cooperation trumps competition

11:30

AIR CL9 Reverse-Engineering the Brain

William Risk

=============== PRE-presentation notes

Erez has introduced a new SUMMARY Etherpad:

/Pad-One-Liner:

Please contribute.

Slide marker in Etherpad:

-

at the left margin, the hyphen above indicates a new slide.

If someone wants to put in the TITLE of the slide, like this

- Example Title

that would be even better.

[ref]

If you need a reference, use this marker.

If you missed it on Saturday, July 10, Gregg Maryniak gave a second full presentation on Energy starting from line 693 in this pad:

/core-Jul10-EES

He also gave a third full presentation to the Space team on Sunday, July 11:

/Jul11-GM

Aubrey de Grey spent some time in 583C talking about SENS on Sunday afternoon, 11 July:

/event-Jul11-AD

PRIOR AIR pads:

Jun28 AIR CL1 Overview AI Robotics Jacobstein

/core-Jun28-AIR-CL1-Overview-AI-Robotics-Jacobstein

Jul5 AIR

/core-Jul5-AIR

Jul12 AIR

/core-Jul12-AIR

Spreadsheet of all core Etherpads:

http://bit.ly/GSP10library

Link to full SU Etherpad index:

/gsp10pads/

=============== End of PRE-presentation notes

Adam Cheyer

/about.html

Siri founder

/

\"Siri understands what you say, accomplishes tasks for you and adapts to your preferences over time.

Today, Siri can help you find and plan things to do. You can ask Siri to find a romantic place for dinner, tell you what\u2019s playing at a local jazz club or get tickets to a movie for Saturday night.

Siri is young and, like a child taking its first steps, may be awkward at times. Siri may occasionally misunderstand things you ask it to do even within its range of understanding.

Nonetheless, Siri will improve quickly by getting to know you better and understanding a broader set of tasks. In fact, right now, Siri\u2019s learning how to handle reminders, flights stats and reference questions. Our vision is that, over time, you\u2019ll trust Siri to manage many personal details in your life - from recommending a wine you might enjoy to managing your to do list.\"

YouTube demo: /watch?v=MpjpVAB06O4

/

\"the premier social network for positive social change\"

/companies/sandwalk-capital-hk-limited

Sandwalk Capital is an asset advisory firm specializing in the development and support of systematic short-term trading Investment Strategies in the most liquid markets. We focus on advanced pattern recognition systems using proprietary evolutionary algorithms and a robust testing and evaluation framework to uncover new sources of alpha.

Slides: /news.html

AI: What's Possible, What's Not, How Do We Move Forward?

9:09am Neil: [bio]

Siri recently sold to Apple

See free iPhone app (AI agent)

/

Author of more than 50 peer reviewed papers and 9 patents.

Adam: Really impressed. Kudos.

Updated version of talk from last year.

Questions:

- The Future of AI

What's missing?

What works well? Where are the gaps?

Where are we today?

What are the best AI engines - limitations?

What is the best hope of success? low hanging fruit?

Where can we break through?

Predictions ...

- video from 1986 - Apple - about 10 minute video

Really sets the bar for an assistant.

How close are we.

We have the touch phones

We have the internet

Interacting with human

Awareness of temporal and social context

What is happening in a person's life, how does that fit

Phone has all contacts

We have continuous speech both in and out.

Here we see conversational assistants.

Artificial Intelligence\u2028\u2028What\u2019s Possible, What\u2019s Not, \u2028How Do We Move Forward?

Adam Cheyer\u2028\u2028Co-Founder, VP Engineering

Siri Inc

The Future of AI

AI: What are we trying to achieve?

What does it require?

Why is it hard?

What approaches are there?

What works well?

What doesn\u2019t?

Where is the state of the art today?

Commercial \u201cAI Engines\u201d

What are our best hopes of success?

What holds us back?

What does the future look like?

In 5 years.... In 15\u2026 In 25\u2026

AI: What are we trying to achieve?

Interaction with the Assistant

Touch screens and cinematic animation

Global network for info and collaboration

Awareness of temporal and social context

Continuous Speech in and out

Conversational Interface - assistant talks back

Delegation of tasks to the assistant

Assistant use of personal data

Is the Knowledge Navigator vision \u2028possible today?

Is the Knowledge Navigator vision \u2028possible today?

How Close are we Today?

Touch screens

Cinematic effects

Global network

Location and time awareness

Speech out, on demand

Continuous speech to text

Our iPhone has all these pieces.

Being able to communicate, delegate, etc.

You just can't talk to a search engine this way.

Peter Norvig was here.

John Battel wrote - a conversation [ref]

Why is it hard?

Each component technology is complex

Not enough to have dialog models, task models. You need to put it all together.

Each component is quite difficult.

\"Book 4 star restaurant in Boston\"

The word \"book\" is an object, a city ...

\"Star\" is a restaurant name ...

There is a restaurant called \"Restaurant\" ...

It explodes into a huge possibilities ...

If you try to put the raw semantic interpretations into grammar.

Informal, incomplete grammar of English is larger than 1,700 pages\u2028\u2028

R. Quirk et al., A Comprehensive Grammar of the English Language, Longman, 1985.

What is the meaning, the intent. Especially when the words come in context.

Why is it hard?

\u201cCommon sense\u201d knowledge is fundamental to all components

Don\u2019t yet have sufficient representations for logical reasoning

*Huge* amounts of knowledge required, where does it come from?

How to manage the scale of the two?

\"Journal articles only\" set of results too large.

All of that knowledge would need to be encoded in a computer.

What is the right representation for putting in these facts and rules.

Huge amounts. How do you encode in a reasonable way.

Each component area uses different technologies, languages, methods yet \u2028deep integration is fundamentally required

You can't do this at a superficial level. DARPA spent $250 m. Funded stove-pipe research. Ontologists. Linguists. Planning specialists. Machine learning. CALO taught about movies? Make changes across entire set of technologies - words, rules, objects - very difficult to bring all the people together quickly.

- What approaches are there?

Simple heuristic rules plus enormous computation (search)

\u201cDeep\u201d knowledge approach

Typically relies on hand-coded grammars, ontologies, and rules

Statistical approach relying on learning probabilities from large corpora

Examples: Search will take Page Rank as one metric. Try to optimise on certain criteria. Look through entire set of data and evaluate on this criteria.

Can have very simple rules, but lots of power.

2/

Someone is going to code up knowledge. Autonomous vehicle. Not a search problem. Techniques were domain specific.

3/

Stat approaches. English and French - you just train. Run algorithms. Gee, when I say \"book\", then \"livre\" in French might be good.

-What works well?

All the approaches work well \u2013 for some problems

Massive search with simple heuristics

Deep Blue beats world chess champion

Genetic Finance beats benchmarks on stock prediction

Massive distributed learning. Like SETI at home. Pretty picture shows and it starts crunching. Rather than look for intelligent life, we look at the stock market. Run on millions of computers. Which indicators are most useful is a massive search problem. They get exponential in size.

Statistical training based on massive data

Speech recognition

Purely a data problem. Here are the words, here are the phonemes. Let's match them.

Machine translation

Google has orders of magnitude more data. Google vs Bing Translate - data helps.

Web search

Read: \u201cThe Unreasonable Effectiveness of Data\u201d [ref]

Norvig - algo that work OK with 10 million make leaps with order of magnitute more data.

\u201cDeep\u201d knowledge approach

Urban Challenge/Robotics

Multiplayer Virtual Games

Someone has coded up rules.

- What doesn\u2019t?

But they have their limitations

Massive search with simple heuristics

Only certain problems fit into this category

Think again of the chess computer. Heuristic - 1 get the king, good position = better score.

In Genetic Finance, make money good, lose bad. Take transaction costs into account.

\"Bring up my rainforest slides\" will not fit this approach.

Statistical training based on massive data

Again, works only for certain problems due to availability of data and shallowness of scope

It is changing - we have video cameras on anything. Get data on how children learn language by hearing every single word they say. Question of getting data is a key lever on are we going to have really intelligent systems. Are we going to have systems to see and \"experience\" the world. In a sense.

\u201cDeep\u201d knowledge approach

Too brittle

Take text-to-speech. Chevaneski? [ref] Changed the world.

How would you pronouce these words?

Took a dictionary - found phonemes.

Took neural network and trained words input to phonemes output.

Started with RANDOM output, system learned to feedback, get better.

Played over time, sped up, you could here the concepts get better and better.

Want to learn Finnish? Just give me another dictionary.

Who comes up with rules is the challenge.

How to get the data?

- State of the Art: AI Engines

Google \u2013 A \u201cSearch Engine\u201d

Amazing.

Wolfram Alpha \u2013 A \u201cCompute Engine\u201d

/

Mathematica at the core

Huge, curated fact base

9:31 video

Brainchild of Stephen Wolfram [ref]

What he did was interesting and somewhat revolutionary.

Put a math engine at the core.

AI people said, \"What? It doesn't do logic?\"

[\"What is the weather in NYC? Current temp, and forecasts, conditions, historical temp data. Let's get even more specific. April 2, 1981. Great for research projects. Here is that pattern, daily breakdown of cloud cover. Type another city. Say Philly. On this day in 1981. So, it's thinking. Side by side comparisons. Very interesting. Do another search.

How much is 440 British pounds worth in US dollars .... over 10 years\"]

What Stephen has done is curated a massive set of data, formulas and rules.

Stephen Wolfram has curated massive ammounts of data, rules, formulas across all areas of science, wolfram alpha, a new type of engine that can answer new kinds of questions

Run in parallel across

Chem

Bio

Astrophysics

He says search engines only retrieve what is known. This can return answers to questions that have never been posed before.

He has 10,000 machines running Mathematica in parallel.

Just type \"6\" and you get all sorts of disconnected facts.

April 2, gives you the number of days ago, in parallel. These different math engines.

Very interesting system.

Who enters this data? He wants precision to the Nth decimal point.

The idea of Wikipedia is abhorrent to him.

He has developed tools to manage the quality of the data - the actual quality is one of the most important achievements. It will advance at the speed he can get his experts to curate that data.

True Knowledge \u2013 An \u201cInference Engine\u201d

/

Chains inferences together, reasons about time

Collaborative knowledge entry for enhancing KB

You can ask who was President when Barack Obama was a teenager?

First who is Barack Obama.

Answer - actually 4 Presidents during his teen years.

This is collaborative.

You could hire guys.

This is trying to create an application - if it doesn't know, it asks, \"Do you know answer?\"

[video \"Big problem - computers don't understand the content of websites. Just keywords ... \"Is Jennifer Lopez single?\" Represent knowledge in a format that computers can understand. Can be used just like a search engine. When you type in a question this time, you get a perfect in-line response. Disambiguated meaning of \"single\".]

skipping ahead

[\"Users can can contribute templates. Enter facts in plain text.\"]

They are typing where was Jennifer Lopez born

[\"Can add knowledge. Confirmation screens.\"]

By NYC - did you mean New York, New York?

Building an end user app, adding data is very important to get to the scale.

Let me show 2 more, then pause for questions.

IBM\u2019s Deep QA \u2013 An \u201cEntity Retrieval Engine\u201d

[Watson video from IBM \"It's going to change how we interact with information\"

What is empricism.

Pose question in natural language. An information seeking tool to make sure you get what you want. I don't have one of those.

A human standing there with carbon and water.

The computer standing there with silicon and disk.

Questions are tricky.

I think we've gone from impressed to blown away.

Reality is, being able to win a game does not mean you have conquered the language understanding task.

Worst is when WATSON crashes.

Or just starts making mistakes ... NO. \"HUMANS - Woo!\"

Push technology as hard as we possibly can.

What can we really do. It is limitless what we could apply this to.

[YouTube ref IBM and the Jeopardy Challenge]

/deepqa/

Statistical retrieval of concepts/entities

Wolfram - clean

True K - inference

IBM - words/entities

Siri Virtual Personal Assistant \u2013 A \u201cDo Engine\u201d

Reasons about capabilities of external services

Conversational (spoken) interaction, with context

Personalized: learns and applies info about user

Siri, my own company, a \"do\" engine.

Does conversation - takes context. Next night. Action movies. No, closer to my house.

Reasons about capabilties of other services - basically web services.

User interface on iPod.

Number of services - analyzing source or sources to provide best answer.

Siri - now that TK and Wolfram - may send to those APIs.

/wiki/Application_programming_interface

[Siri video]

\"I can show romantic place. Send it to a friend. If you know place you want, ask for reservation directly. Siri contacts OpenTable to see what is available. Movie? Avatar in 3D IMAX? Siri checks within the context of my dinner plans. See trailer, read plot, map theatres, get tickets from within Siri.

Ask open questions. \"What is happening this weekend around here?\"

Siri knows where I am because of the phone.

You interact with a dialog.

Check a different location \"How about SF?\"

Conversation about events carries over.

Lot of theatre up there - Wicked still showing.

\"Take me drunk. I'm home\"

Right thing to do is call me a cab]

9:51 [applause]

All available for free. Competitors, but I show them to you because they are great.

You can kind of see the flaws and the good parts.

Architecture connects services to \u2028what people do, where they are.

Knowledge

Data

Language

What are our best hopes of success?

Integrating many AI components into single system

Despite CALO. It is going to be a little bit of a while before they integrate.

With Siri, let the best flowers bloom

Learning from Massive Data

Web, but soon all books, music, tv/video, \u2026

We need more.

Learning from Massive Usage

Google has advantage over Siri. We went from 0 to modest number.

Where do they click. How do they use system.

The internet population is growing at enormous rate

Learning from Active Teaching & Collaborative Intelligence

Wikipedia approach vs Wolfram Alpha

Hybrid probabilistic/logical approaches

WA, TK, great on symbolic.

Google great at probablistic

Deep QA from IBM combining a bit

SIRI a bit

need to improve dramatically

Or\u2026 something completely different

Allen institute for brain science?

slicing up brain. Trying to build a map. Reverse engineer.

- What holds us back?

Software

Brittle/fragile

\u201cAnti-Moore\u2019s Law\u201d \u2013 gets slower

Ex: boot \uf0e0\uf020MS Word

In 1988, ran MS Word on 33 MHz. Windows started faster for me then.

Just a cautionary tale.

Software - anti-Moore's law

Human understanding moves slowly

Engelbart: co-evolution of technology and human understanding/adoption

In 1968 he did demo so far ahead of time

/wiki/The_Mother_of_All_Demos

read/write internet with video conferencing - fade in voice

wireless

when you clicked on link - express how you wanted to see link

Ideas on ideas. In a few years it will be done.

Still taking people a long time to get their heads around it.

Idea of mouse took off

Whole idea of links ...

1998 - I was watching and internet was just taking off.

Ex: collective intelligence progress\u2026

- AI in the future: 5 Years\u2026

Everyone will have a Siri-like assistant and will rely on it increasingly for

mobile tasks

Maybe shorter time. Now acquired by Apple.

internet tasks (e.g. travel, e-commerce)

communication tasks

entertainment/attention

- AI in the future: 15 Years\u2026

Common sense knowledge models and reasoning components begin to be more feasible \u2013 systems seem \u201csmarter\u201d, more general, are less brittle, make less stupid mistakes

Contributions from the masses

Scale issues in probabilistic/logic start to resolve

- AI in the future: 25 Years\u2026

Too far ahead. That is for you guys.

- Poll Question

Robocup goal successful?

By mid-21st century, a team of fully autonomous humanoid robot soccer players shall win the soccer game, complying with the official rule of the FIFA, against the winner of the most recent World Cup. [ref]

[video Robocup 2010 Best Humanoid - YouTube video]

Adam Cheyer

adam@

Siri available for free \u2028in the Apple App Store

Q: Siri - on Blackberry?

Can't tell you.

Q: Bryce: In the search engine that let's you make suggestions. More Wikipedia based model. Does it rank answers? If \"do you know where Jennifer Lopez was born\" - OK to discard data entries/but not these?

TK has conflict resolution. If a human enters fact and it has logical conflict, it will warn you. J Lopez born in 1892 - but married in 19 something - does not compute. Will show you inference chain. Quite a system to maintain consistency.

Q2: How much thought geiven to combining human intelligence with ...

Amazon Turk. Turn humans into robots. Post tasks too hard for computers. Army of humans paid to do certain tasks. Identify face in this picture. Every time you do it you get money. Get human assistants.

In Siri, we don't have people in India. Fully automated. Some companies do use mixed solution and have some success.

Q2 followup: Could you use human intervention to improve AI.

If it is ground truth, that is data that machine learning can use -- if you get enough of it.

Connor: K Navigator video inspiring.

When can you ask Siri financial questions?

Ask, \"How can I make lots of money?\"

I'd say Siri will be able to answer that once we get a trusted source.

It will delegate.

Yahoo answers, \"Should I leave my girlfriend?\"

Asking about money - WA will give list of richest people in the world and you'll see you are not in it.

Q: Eric/Italy: In past few weeks, is there some kind of AI that is already operating that we don't recognize. Financial system beyond our control?

So, for me, AI is by definition. As soon as it works and you take it for granted, then it is not AI.

Is AI working that we don't understand - Google maps - just take it for granted.

When you talk about finance. Systems traded entirely by computer. Competing against humans and doing quite well. Blazingly fast.

Subverting the world? I don't think so.

Q: Is Siri tied to resources, conversationally. AGI will be a compilation of a bunch of narrow AI?

Probably the question. I don't have the answer. My approach to AGI is to take the best, the first, as many reasoning systems as you can and try to learn which are useful for which tasks. At a fundamental level that may be the way the brain works.

In Watson, they have reasoners.

Surprised how hard Jeopardy questions are.

Eddie Albert Camu?

Watson got it correct. How to coallesce and compound answers.

Reason about the different sources.

They way I know to go about it. Have very specific reasoners -

Open Table would be highest rated, but

All Menus would know if lasagna is on menu tonight.

May be completely different, more holistics approaches.

Q: Emiliano. What other areas are interesting?

Third company. . Help solve world's problems. A lot of what you guys are about.

AI for mediating perspectives.

Look at global problems.

Solve crime, proverty - no one person will have \"the\" idea. A collaborative process.

A system that is realtively neutral. One that can document and do conflict resolution.

Here are inconsistencies.

Transcribe, annotate across multiparty discussions.

Bring in best data.

Make it available.

Make it fit into this shape.

How do we as humanity move forward.

A computer aided assistant could be very helpful.

Neil: Let's give Adam a big hand.

5 min break

10:11

Markov NY Times article on robot teachers.

/2010/07/11/science/11robots.html?_r=1

10:19

Neil: Dan Barry - teacher of collaboration and communication.

[slide of geese in V formation]

Dan: So. Robot lecture. Focus on collaboration.

Last time adaptation.

The last time I talked to you it was about adaptation, but before that you need collaboration

Take home message: \"Cooperation trumps competition\"

How could that be? Cooperation is part of the definition of life.

Is it competition that wins out in the primordial soup? No, there is cooperation of molecules that get together, get organized.

Eventually you get lipids, then a cell ... life.

In order to get multicell organism again you need cooperation between cells.

Birds flying in a V is an example of cooperation within a species. Other examples: bees, ants, lions, wolves, naked mole rats (/wiki/Naked_mole_rat)

Penguins, Ants, Dolphins

Interspecies cooperation = bacteria

10 times bacterial cells than body cells

100 times more DNA in bacteria than in our cells

Appendix is a way for the bacteria to survive and reboot your body's bacteria levels in the event your bacteria gets wiped out

Prisoner's Dilemma /wiki/Prisoners_dilemma

You and your buddy get busted and then separated

1. If one rats the other out, person who rats gets reward, person who gets ratted on gets severly punished

2. If neither rats than both get out

3. If both rat than get slightly punished

Tit-for-Tat

/wiki/Tit_for_tat

New strategy beats tit-for-tat.

Team had 60 entries, some always cooperated, some never cooperated.

Half were best players. Other half were worst. If you are willing to sacrifice. What you see in Tour de France (bicycle race).

Douglas Hofstadter /wiki/Douglas_Hofstadter

suggests \"super rational\" approach - with the thought that since both players are rational and know the other player is rational they will both cooperate with eachother

80-20 rule /wiki/Pareto_principle

Take it or leave it, take 50?

How many people vote yes. How many no. Some people don't vote.

How about 60/40? Have no's now. 10-20%.

Suppose person says, going to take $100.

$70/$30.

$80/$20

$90/$10 yes

Where did half say yes? At 80/20.

Your choice is to either get $20 or nothing.

In this test, the other guy doesn't exist. I was pretending. You were turning down $10. Isn't that interesting.

If we think the other guy is too greedy we will hurt ourselves to punish the other guy.

Even at $99/$1 - do you want a dollar or not? That was the question.

Almost everybody says, hell no.

Interesting.

One thing I wanted to mention. Individual winning tends to make you happy. But team winning makes you happy for a longer time.

Which is more satisfying; Playing longer on a team that ultimately loses OR play by yourself and win championship.

About half/half.

What was the best thing about space flight?

- seeing Earth

- flying, feeling like magic

- by third flight - best thing was being on team - having those friends for the rest of your life.

Robot applications.

cooperation - mutual benefit. Robots will want something out of the interaction.

Like with dogs. Other animals.

Video which demonstrates people are ready to coorperate with robots.

Tween bots. All robot does is go in a straight line. Asks, via sign, \"Help me\"

It is cute and asks for help.

\"I love this guy. He followed, trailing. Before starting to help.

Day I did this was really really hot. Tires got hot and came off. These guys figured out Sam was missing the tread. Talked about it for some time. Discovered tread was right there. Put tire back in order and sent him on his way. One of the things I found amazing. Never know how deep the level of engagement will go. This girl was amazing. Actually talking to herself\"

This robot - 30 different people help it. People bonded with this trivial robot.

There we are, helping this robot. People so happy to be helping this robot.

Also

Showed you swarm.

Cooperate to get tasks done to

Help me find applications where it is a two way street where robots and humans help each other.

EXAMPLES OF HUMAN/ROBOT COOPERATION

Use web or talk together.

1. The Matrix

2. Automatic vacuum cleaners (not roomba) - vacuum cleaners get plugged into walls and guided by humans, cooperate with humans in cleaning

3. Research robots - can collect data that the human can then analyze, humans have to set up the parameters to research

4. Blood cell robots - fighting disease or releasing oxygen inside human while human provides energy

/wiki/Respirocyte

Matt: cells to transport oxygen. Blood would provide energy.

Dan: Just the sort of thing. Robots in your bloodstream. You provide energy for them to live. A symbiosis. Nice concrete example. That's the kind of thing I'm looking for.

5. Exploration robots

Emiliano: send out, report back

Dan: What have you done for robot? That's a one way street.

6. Rechargable robotic limbs that need repairs

7. Ant construction robots using swarm behavior to build structures

/wiki/Ant_robotics

8. Robocars acting together

9. Intelligent homes and cars that work with humans to maintain optimal and efficient energy usage and overall mutual existence

10. Captcha /wiki/CAPTCHA - helps the computer to understand \"English\" - gives humans secure login

Matt: You type in mixed up words. AI starts to recognize more complex patterns. It helps with security solution.

11. SETI at Home /wiki/SETI#SETI.40home - swarm of robots

12. Davinci robot, operated by humans, gives doctors more precision and better view

13. Army bomb defuser bots, predator drones

14. Symbiotic relationship between \"walking stick\" robot and blind individual. The robot gains body heat for energy and the human gains \"sight.\"

15. Self-winding watch.

16. Human with internal robot -- both have to agree on actions.

17. Learning or helping

18. hiking helper -- we give it learning, maintenance, exposure to new environments; it gives us carrying help.

11:09 wrap up.

: Robots playing a game. Feedback - robots entertain people.

Dan: What do robots get?

Play

Dan: OK if robots get reward. What do robots want? They only want what we told them we want.

People in park not helping robot but person who invented the robot.

From the individual's point of view, they were helping the robot.

Through your whole life, parents tell you to go to medical school. You finally get a prof to give you a letter of recommendation to med school. Is that prof helping you or your parents?

Bryce: Middle sibling. An 8 yr old and a 4 yr old. The 8 yr old teaches the robot. For the 4 yr old, the robot can take on a teaching role. Learning from and doing the teaching.

Dan: Robot gets to be loved. I think that is a motivation. We are starting to get to program emotions. Middle sibling helps with sibling rivalry.

Emiliano: Marketplaces where you can outsource program tasks. Choose which tasks. Bots which can outsource to humans the improvements

\\\\\\\\

[sorry pad died]

Better sensors. Exoskeleton. Win world cup. Learn mobility/agility.

Dan: Sport robot that is the kind of thing I was looking for.

You want robot to win as a roboticist. They become more agile, develop better balance.

With sense of self, being able to move would be valuable.

Owners and players. In sport, you train players.

Maggie: Robot to assist a blind person. Robot would get energy from body heat.

Human would get better mobility.

Dan: Seeing eye dog

Maggie: Walking stick

Dan: Not sure body heat is enough. But you are touching on wearable clothing - wrapped around you, powered.

Wearable robotics that enhance your function. I like it.

Something about the seeing eye robot that has to do with independence.

Roles we are assigning are very high level functions.

Not clear robots would care about these things.

Hard exercise to REALLY effect the goals of a robot.

Candice: How do you know it has emotions and not just programmed to look like it does?

Dan: How do I know you have emotion? It's a classic philosophical argument. Does a fly have emotions? No. A cat? Absolutely. Where do you draw the line.

Will be exact same thing in pragramming.

Not sure we ever will be able to draw the line.

The programs we have now, doesn't have emotiton, draw a line in the animal kingdom when an animal has an emotion and know that and I'll let you know where the line is in understanding robot emotions.

Candice: We never developed outside our species.

Dan: Fair enough. May be very difficult for us to draw the line.

End with story.

Judge life by winning. Not about your accomplishments. About other people in your life.

If you successfully find a true love, your life will be amazing.

Seattle Special Olympics, Fred Rogers:

For the 100 yd dash, 9 contestants lined up

at sound of gun, they took off.

not long afterward a little boy, fell to the ground hurt his knee and started to cry

other 8 heard him crying, turned around. Every one ran back to him.

one little girl iwth down syndrome bent down to kiss his knee and said

\"This will make it better\"

The all linked arms and

All finished race at the same time.

Everyone stood up and cheered for a long long time.

What really matters is helping others win.

11:25 [applause]

Neil: Restart at 11:35 for Bill from IBM

Dan: How to breed chickens. Over 6 generations of picking best INDIVIDUAL layers, chickens plucked one another to death. Need to identify CLUTCH of chickens that produce the most eggs.

[Actually, \"clutch\" refers to the group of eggs: /wiki/Chicken ]

/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////

AIR CL9 Reverse-Engineering the Brain

William Risk

published over 15 patents

- Cognitive Computing via Synaptronics and Supercomputing

Thank you.

Speaking on behalf of colleagues at IBM Almaden.

Setting is a very beautiful one.

This work includes contributions of work by colleagues around the world.

More recently ccollaboration with DARPA.

- Your (very) personal computer

Here is the spec sheet.

Weight - 1.5 kg

Volume 1.3L

Power ~ 20W

Processors: 10^11

Interconnects 10^15

\"Wiring\" ~150 km

Good at taking inputs and integrating into a coherent view.

We've been working on building computers to do something like this.

Make sense about how to act in noisy environment.

- Dual Objectives

Facilitate discovery

Glean from neuroscience

- Intersection of Neuroscience / Supercomputing / Nanotechnology C2S2

- Inflection Point 1: Neuroscience has matured

- Nobel Prizes in Nerve Signaling

Nice page [ref]

nobel_prizes ...

- Classic Neuroscience Textbook. 1400 pages [ref]

Erik Kandel, most often used text book (Principles of Neural Science)

- Neurons ~10,000 inputs

Dendrites, Soma, Axon

~ 10,000 outputs

On scale of 10s to 100s of microns in size.

Complex \"arbor\" of connections.

- What Neurons Do

Membrane reaches threshold, emits spike

- Communication between Neurons

via synapses

\"pre and post\" synaptic neurons

- Brain Scaling

16 m Neurons in mouse, 20 b Neurons in Human

- One way flow - 20 - 40 nM gap at synapse. From Graham Johnson.

Conductance strength - learning takes place. Memory.

Similar to electrical resistor.

How are memories stored? Lots of theories.

- Spike Timing Dependent Plasticity (STDP)

If neuron 1 spikes and then a short time later 2 spikes, there is likely an influence.

If 2 fires first, then 1 fires, unlikely there was an influence.

Increase / decrease conductance.

- Structure of Brain.

Over a century of neuroscience.

Gray Matter - 2-4 mm thick.

Zoom in, find dense packing of neurons.

White matter, just axons.

So, local and longer range connections.

- Cortical Organization: Layers

Typically 6.

Specialized for different functions.

Receiving,

Sending to other areas

- Layers in the Cat Cortex

Very careful tracing of cat cortex

Some lateral organization.

Cortex is not just in layers, but in columns. Particular functions.

Larger regions

- Regions

Visual

Audition

Motor functions

etc.

cortex is a 2 dimensional object, or maybe 2 plus epsilon.

Covers about 4 sheets of notebook paper side by side.

- Monkey Cortic